Os01t0342700-00

Locus

Os01g0342700

Description

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

PDR16

CGSNL Gene Name

PLEIOTROPIC DRUG RESISTANCE 16

Oryzabase Gene Symbol Synonym(s)

OsABCG32, OsPDR16

Oryzabase Gene Name Synonym(s)

ABC transporter superfamily ABCG subgroup member 32, pleiotropic drug resistance 16

Transcript Evidence

Protein Evidence

Literature

Note

Manual Curation

Expression Databases

TENOR (Os01t0342700-00)

Others

Oryzabase (12008)

Transcript

360 bp

>Os01t0342700-00
ATGGCGAGAGAGATCCACAAGATCGCGAGCCTGAGGCGGGAGAGCTCGCTGTGGAGGCGG
GGCGACGACGGCGTGTATTTCTCGCGGTCGTCGACGGGGGCGTCGTCGTCGAGGTTCAGG
GATGAGGAGGACGACGAGGAGGCGCTGCGGTGGGCGGCGCTGGAGCGGCTGCCGACGCGG
GACCGGGTGCGGCGGGGCATCCTGCTGCAGGCGGCGGAGGGGAACGGCGAGAAGGTGGAG
GTGGACGTCGGCAGGATGGGCGCCCGCGAGAGCCGCGCGCTCATCGCCCGCCTCATCCGC
GCCGCCGACGACGACCACGCCCTCTTCCTGCTCAAGCTCAAGGACCGCATGGACAGGTAA

CDS

360 bp

>Os01t0342700-00
ATGGCGAGAGAGATCCACAAGATCGCGAGCCTGAGGCGGGAGAGCTCGCTGTGGAGGCGG
GGCGACGACGGCGTGTATTTCTCGCGGTCGTCGACGGGGGCGTCGTCGTCGAGGTTCAGG
GATGAGGAGGACGACGAGGAGGCGCTGCGGTGGGCGGCGCTGGAGCGGCTGCCGACGCGG
GACCGGGTGCGGCGGGGCATCCTGCTGCAGGCGGCGGAGGGGAACGGCGAGAAGGTGGAG
GTGGACGTCGGCAGGATGGGCGCCCGCGAGAGCCGCGCGCTCATCGCCCGCCTCATCCGC
GCCGCCGACGACGACCACGCCCTCTTCCTGCTCAAGCTCAAGGACCGCATGGACAGGTAA

Protein

119 aa

>Os01t0342700-00
MAREIHKIASLRRESSLWRRGDDGVYFSRSSTGASSSRFRDEEDDEEALRWAALERLPTR
DRVRRGILLQAAEGNGEKVEVDVGRMGARESRALIARLIRAADDDHALFLLKLKDRMDR*

CDS

chr01:13517534..13517893 (+ strand) : 360 bp

FASTA

>Os01t0342700-00 class=Sequence position=chr01:13517534..13517893 (+ strand)
ATGGCGAGAG AGATCCACAA GATCGCGAGC CTGAGGCGGG AGAGCTCGCT GTGGAGGCGG GGCGACGACG GCGTGTATTT
CTCGCGGTCG TCGACGGGGG CGTCGTCGTC GAGGTTCAGG GATGAGGAGG ACGACGAGGA GGCGCTGCGG TGGGCGGCGC
TGGAGCGGCT GCCGACGCGG GACCGGGTGC GGCGGGGCAT CCTGCTGCAG GCGGCGGAGG GGAACGGCGA GAAGGTGGAG
GTGGACGTCG GCAGGATGGG CGCCCGCGAG AGCCGCGCGC TCATCGCCCG CCTCATCCGC GCCGCCGACG ACGACCACGC
CCTCTTCCTG CTCAAGCTCA AGGACCGCAT GGACAGGTAA 

Locus: Os01g0342700

Loading...

Locus: Os01g0342700

Loading...