Os01t0549700-03

Locus

Os01g0549700

Description

Similar to predicted protein.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

AIP1

CGSNL Gene Name

API5-INTERACTING PROTEIN 1

Oryzabase Gene Symbol Synonym(s)

AIP1, Os AIP1, OsAIP1, OsRH56, OsBAT1, UAP56, OsUAP56, OsBAT1/UAP56

Oryzabase Gene Name Synonym(s)

API5-INTERACTING PROTEIN1, RNA helicase 56, HLA-B associated transcript 1, spliceosome RNA helicase UAP56

Transcript Evidence

AK104852 (DDBJ, Best hit)

Protein Evidence

NP_850807.2 (RefSeq)

Literature

Note

Manual Curation

Full-length cDNA

001-043-B03 (Online Clone Ordering)

Expression Databases

TENOR (Os01t0549700-03)

RiceXPro (AK104852)

Others

Oryzabase (9251)

KEGG (Os01t0549700-03)

Transcript

414 bp

>Os01t0549700-03 Similar to predicted protein.
GTGCAAGAAAGATTCGAGGTTGACATAAAGGAGCTTCCTGAGCAGATTGATACTTCGACA
TATATGCCTTCTTAAAGATCCGGGTGGATTGCTTAAAGCTTACATTCGAACGGAAACGAG
AGTATCTCCTTGAGATACGGCATATTAAGAATCTATCGGATAACTAAAAACTTAGTGTGA
GAAATGCTGCCCTATCTATACTTAGACAGCAGTTTAGATCTGCTGCTAAGTGCTGAATGC
CCCGTAATAATACTTGAAATGATGTATCTGGGCAATTGGGCATGTACGTATTTGAATTGC
AGTCGTTCATTGTAATTCCGAGAATTTTATTAGGATTTGTTTGTGTTAATTTTGCTACTC
CGCAGATGCTAACGTGGGTTAGTTTATAGTACTTTGTTTATGGTACTTTTGAGG

CDS

75 bp

>Os01t0549700-03 Similar to predicted protein.
GTGCAAGAAAGATTCGAGGTTGACATAAAGGAGCTTCCTGAGCAGATTGATACTTCGACA
TATATGCCTTCTTAA

Protein

25 aa

>Os01t0549700-03 Similar to predicted protein.
VQERFEVDIKELPEQIDTSTYMPS*

CDS

chr01:20546524..20546587 (+ strand) : 64 bp

chr01:20546689..20546699 (+ strand) : 11 bp

3'UTR

chr01:20546700..20547038 (+ strand) : 339 bp

FASTA

>Os01t0549700-03 class=Sequence position=chr01:20546524..20547038 (+ strand)
GTGCAAGAAA GATTCGAGGT TGACATAAAG GAGCTTCCTG AGCAGATTGA TACTTCGACA TATAGTAAGT GTTGTTTACC
TTGTTATTCC AGATTAATTT GTAATACCAT ATCATATGAT TTGTTCAAAG AACTGATTTG TTGTATTTTG ATTTGTATTT
TCCAGTGCCT TCTTAAAGAT CCGGGTGGAT TGCTTAAAGC TTACATTCGA ACGGAAACGA GAGTATCTCC TTGAGATACG
GCATATTAAG AATCTATCGG ATAACTAAAA ACTTAGTGTG AGAAATGCTG CCCTATCTAT ACTTAGACAG CAGTTTAGAT
CTGCTGCTAA GTGCTGAATG CCCCGTAATA ATACTTGAAA TGATGTATCT GGGCAATTGG GCATGTACGT ATTTGAATTG
CAGTCGTTCA TTGTAATTCC GAGAATTTTA TTAGGATTTG TTTGTGTTAA TTTTGCTACT CCGCAGATGC TAACGTGGGT
TAGTTTATAG TACTTTGTTT ATGGTACTTT TGAGG

Locus: Os01g0549700

Loading...

Locus: Os01g0549700

Loading...