Os01t0559550-00

Locus

Os01g0559550

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

Transcript Evidence

CT834992 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Expression Databases

TENOR (Os01t0559550-00)

Transcript

715 bp

>Os01t0559550-00 Non-protein coding transcript.
CAATTAGATAATGAGTGTGGCCATTGTCTAGCTAGCAGTTTTACTTAGAATGCAAGGTGT
TGCTTTGAAGGTTCAACAATCCATACAGGCAGACTAAGATGAAATACTGGACCAGAGTAT
CTGCTAATTCACACGTCCCTTTCAATGTGAGATATTCTTTTCATGCTGCTAAGCTGAACG
ACAGAGGCTACTCTATGATTGTCCTCACACTAACTGCCAGTTACAAGATCTTTTGATTAA
AATTATCCTATCAATTTGAGTCCACATATATTTCGATACATGTACATTAGATTCCTGCAT
ATATGTATTAGTAGTATTTTAGCTTGTTAGTACAATCTTGTTGTCTACGGAGTACCTAGG
TAACCTATAAAATTTTGTGCTGTGTATTTGTCCTCTATCTGATTCTCTGTGCTATGATCA
TCTGGTAATCAGTGGCTGTTCCAAGTTGTTCTACTCAGCTTCCTTCCAGTTCTTTGCACC
CAGCCATCAACAGATAAGTTCGTTTCATCAGGACGAATTCTCTGTGTAGAAAATTATCGG
CATATTTATTTGAGTGGGCCATCATTTCTGTGTCAGCAGGCAAGAATAGCTTCCAATAAT
CATGTTGGGTTTCTAATGCTGCAGGCATTATCTTGTCCTCTAGTAGTAGTTTTTTTTCCC
CCTAAACAATCTATTTCATGCTGTTTGGACTTTGTACGGATGGGGGAAAATAAAC

FASTA

>Os01t0559550-00 class=Sequence position=chr01:21201971..21203280 (+ strand)
CAATTAGATA ATGAGTGTGG CCATTGTCTA GCTAGCAGTT TTACTTAGAA TGCAAGGTGT TGCTTTGAAG GTTCAACAAT
CCATACAGGC AGACTAAGGT ATGGAAAGGG TGTACGGTGA GAAATCTTGA GTTTGGAGCA GAATAAGTCC AGTTACTGCT
ATTTTTTCCT ATTTTCATTT TATGATCAGG AATGAGTCAA TTGATCAATA AGCTGATATC CTTTTCTTTA GAAAATTATG
TTCATAACAT GCTGTTTTCT CCTTGCTTTG CTGAAAGAAC CCTAAGCTTC ATCTGGAGTC CAGCAATGCA TGTGATACTG
AACCTATTTA GAACCAGAGG ATTCTAGTTA CAATTAGATT AGCTATGCAA ATTAAATTTT GGAACACCTT CTAGTTAAAA
GCACTGCTAT TGTAGGGGAT TGCCATGTGA AATGATCCTT TTATTGTGTG TGACCTTATA ACTTCTAATA GTACTGTAAA
ATGTATTATG GAGAGTTTTA AACTAAAATT ACTTCATGGG TGTGGATCAT TGGGTATCAT TGTCGAGGTA AACTTGGATG
TCAATTTGTT CTTTTGCTTG AAAAAACTCA GTTTTGGCCA ATTCATACAT TAAGACATCA TTTTCGTAGA TGCGTCTAAG
GCAAGAATTG GCAGGCAGCG ATGTAAAATA ATAGCTGATT TTTTTTTTGT CAGATGAAAT ACTGGACCAG AGTATCTGCT
AATTCACACG TCCCTTTCAA TGTGAGATAT TCTTTTCATG CTGCTAAGCT GAACGACAGA GGCTACTCTA TGATTGTCCT
CACACTAACT GCCAGTTACA AGATCTTTTG ATTAAAATTA TCCTATCAAT TTGAGTCCAC ATATATTTCG ATACATGTAC
ATTAGATTCC TGCATATATG TATTAGTAGT ATTTTAGCTT GTTAGTACAA TCTTGTTGTC TACGGAGTAC CTAGGTAACC
TATAAAATTT TGTGCTGTGT ATTTGTCCTC TATCTGATTC TCTGTGCTAT GATCATCTGG TAATCAGTGG CTGTTCCAAG
TTGTTCTACT CAGCTTCCTT CCAGTTCTTT GCACCCAGCC ATCAACAGAT AAGTTCGTTT CATCAGGACG AATTCTCTGT
GTAGAAAATT ATCGGCATAT TTATTTGAGT GGGCCATCAT TTCTGTGTCA GCAGGCAAGA ATAGCTTCCA ATAATCATGT
TGGGTTTCTA ATGCTGCAGG CATTATCTTG TCCTCTAGTA GTAGTTTTTT TTCCCCCTAA ACAATCTATT TCATGCTGTT
TGGACTTTGT ACGGATGGGG GAAAATAAAC 

Locus: Os01g0559550

Loading...

Locus: Os01g0559550

Loading...