Os01t0822900-04

Locus

Os01g0822900

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

PTD1

CGSNL Gene Name

PHOTOPERIOD-THERMO-SENSITIVE DWARFISM 1

Oryzabase Gene Symbol Synonym(s)

OsLTP1.2, OsLtpI.2, OsPTD1, Psd1

Oryzabase Gene Name Synonym(s)

non-specific lipid transfer protein 1.2, lipid transfer protein 1.2, type 1 non-specific lipid transfer protein 2, Photoperiod-thermo-sensitive dwarfism 1, Photoperiod-sensitive dwarf 1

Transcript Evidence

AK058275 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-013-C04 (Online Clone Ordering)

Expression Databases

TENOR (Os01t0822900-04)

Others

Oryzabase (13511)

Transcript

357 bp

>Os01t0822900-04 Non-protein coding transcript.
GATAAACTAGGGCGGCCGGCCTGATGCGTACGTGTGTGCCCGCGCCTCCCGTACGAGAGG
AGAATAAAATGTCATTAGTACCATCAAATTAAGCTAGCTAGTTAAGCTTTACGAAAATCG
ATCCCTTTCTTCCTCTGTGGTGTTTAGCAGTTTAGGGATCGTATGTCTCCACAGTTCCTA
CTATAGTGTCGCTTGGGCGATGGTGGAGCTATATTGTGCACTTTATAAGGTGGTGTTATT
ATGTAACGCCTGTGCTAGCTTTGGTCCTGATGTTCTCCATGTGAACTGTGTCAACCGTCC
ATTGTTCTGCAAATCTGCAGTATGTACTGTGTGTGATAGTATCAAGCTGAACTTCTG

FASTA

>Os01t0822900-04 class=Sequence position=chr01:35130020..35130376 (- strand)
GATAAACTAG GGCGGCCGGC CTGATGCGTA CGTGTGTGCC CGCGCCTCCC GTACGAGAGG AGAATAAAAT GTCATTAGTA
CCATCAAATT AAGCTAGCTA GTTAAGCTTT ACGAAAATCG ATCCCTTTCT TCCTCTGTGG TGTTTAGCAG TTTAGGGATC
GTATGTCTCC ACAGTTCCTA CTATAGTGTC GCTTGGGCGA TGGTGGAGCT ATATTGTGCA CTTTATAAGG TGGTGTTATT
ATGTAACGCC TGTGCTAGCT TTGGTCCTGA TGTTCTCCAT GTGAACTGTG TCAACCGTCC ATTGTTCTGC AAATCTGCAG
TATGTACTGT GTGTGATAGT ATCAAGCTGA ACTTCTG

Locus: Os01g0822900

Loading...

Locus: Os01g0822900

Loading...