Os02t0204201-00

Locus

Os02g0204201

Description

Hypothetical gene.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

Transcript Evidence

CT835333 (DDBJ, Best hit)

Protein Evidence

longestORF

Literature

Note

Manual Curation

Expression Databases

TENOR (Os02t0204201-00)

Others

KEGG (Os02t0204201-00)

Transcript

947 bp

>Os02t0204201-00 Hypothetical gene.
CCCCACCCCTCCTTACTCCTCCGCTCGTGCGGCCGCGTGGTGGTGGAGCCTCGCGGAGCT
CTGCCGCCTCACTCCGCCGCCGCCTGCGTTCGCCGCCGCCGCGCGATCGACGCCTCCCTC
CCTCCCTCCGCGCTGGGGGTGGATCCCGCCGCCCCACTCCCCGAATCTCCCCTCCTCTCC
GGTTCGTACCATCATCCCCTCCCATCGTCGTGGGCCGGATCGCGCCGCCGCGGGTTTCGG
GGCCTCCTCGATCTGCTGCGCTGGATGGCTTGGGTGATTCGGCTTGGTTTTGAGGGTTGG
GATGGGGTCGGCGGTCTACGGGTTGGGGTTTTGCGGGTGGCGGTAGGGTTTTGAAGGGGA
GGGGGGGTTTAGGTTGGTGCCGTTGCGTGGATCCTGATCTGGGGTCGCGGAGGTGTGTTG
GGAGTCGTGGTACCGAGCTCAGTTGGTAGGTTGAATGGAGCTCAGATCCCCACTGGCGTC
ACGCTTGGATGCCCGTTGCGTGATTTTCTTCAGAACGCCGCGGTCACTAAGCATGGCGGT
TTTGTTGCTGGCTGATTATTTATTTATTATATGGTGGATGATATTCGTGGAAGATAGGAA
TACTTGGTTATTCGTTATAAAACAGTACCCATGCAGGGGTCGTTTTGTATAGATGAATTT
TGGTGGCCTTGTTACTTGGCATATTGAATTTTGATTGCCCTTTTTGGTGCATGCTTTTAA
GTAAGAAGCTGTTTTACTAGTTTGAACAATAAGATGCACATTTATTAGGGCCAGTGTAGC
TCACGGAGAAAAGACACTGTGGAGGAAGGAGGTTGAATATGTGGGATTTTATTCAATAAA
TGCATGGATATTTAAAGTTATTTTATCTGAAGAGGGATATAATCCAATTAAAAGAAGTGA
TAGCTTCTGTAATTTGCATGATCTGCATATATATGGGGATCAATATG

CDS

291 bp

>Os02t0204201-00 Hypothetical gene.
CCACCCCTCCTTACTCCTCCGCTCGTGCGGCCGCGTGGTGGTGGAGCCTCGCGGAGCTCT
GCCGCCTCACTCCGCCGCCGCCTGCGTTCGCCGCCGCCGCGCGATCGACGCCTCCCTCCC
TCCCTCCGCGCTGGGGGTGGATCCCGCCGCCCCACTCCCCGAATCTCCCCTCCTCTCCGG
TTCGTACCATCATCCCCTCCCATCGTCGTGGGCCGGATCGCGCCGCCGCGGGTTTCGGGG
CCTCCTCGATCTGCTGCGCTGGATGGCTTGGGTGATTCGGCTTGGTTTTGA

Protein

97 aa

>Os02t0204201-00 Hypothetical gene.
PPLLTPPLVRPRGGGASRSSAASLRRRLRSPPPRDRRLPPSLRAGGGSRRPTPRISPPLR
FVPSSPPIVVGRIAPPRVSGPPRSAALDGLGDSAWF*

5'UTR

chr02:5826284..5826285 (+ strand) : 2 bp

CDS

chr02:5826286..5826576 (+ strand) : 291 bp

3'UTR

chr02:5826577..5827230 (+ strand) : 654 bp

FASTA

>Os02t0204201-00 class=Sequence position=chr02:5826284..5827230 (+ strand)
CCCCACCCCT CCTTACTCCT CCGCTCGTGC GGCCGCGTGG TGGTGGAGCC TCGCGGAGCT CTGCCGCCTC ACTCCGCCGC
CGCCTGCGTT CGCCGCCGCC GCGCGATCGA CGCCTCCCTC CCTCCCTCCG CGCTGGGGGT GGATCCCGCC GCCCCACTCC
CCGAATCTCC CCTCCTCTCC GGTTCGTACC ATCATCCCCT CCCATCGTCG TGGGCCGGAT CGCGCCGCCG CGGGTTTCGG
GGCCTCCTCG ATCTGCTGCG CTGGATGGCT TGGGTGATTC GGCTTGGTTT TGAGGGTTGG GATGGGGTCG GCGGTCTACG
GGTTGGGGTT TTGCGGGTGG CGGTAGGGTT TTGAAGGGGA GGGGGGGTTT AGGTTGGTGC CGTTGCGTGG ATCCTGATCT
GGGGTCGCGG AGGTGTGTTG GGAGTCGTGG TACCGAGCTC AGTTGGTAGG TTGAATGGAG CTCAGATCCC CACTGGCGTC
ACGCTTGGAT GCCCGTTGCG TGATTTTCTT CAGAACGCCG CGGTCACTAA GCATGGCGGT TTTGTTGCTG GCTGATTATT
TATTTATTAT ATGGTGGATG ATATTCGTGG AAGATAGGAA TACTTGGTTA TTCGTTATAA AACAGTACCC ATGCAGGGGT
CGTTTTGTAT AGATGAATTT TGGTGGCCTT GTTACTTGGC ATATTGAATT TTGATTGCCC TTTTTGGTGC ATGCTTTTAA
GTAAGAAGCT GTTTTACTAG TTTGAACAAT AAGATGCACA TTTATTAGGG CCAGTGTAGC TCACGGAGAA AAGACACTGT
GGAGGAAGGA GGTTGAATAT GTGGGATTTT ATTCAATAAA TGCATGGATA TTTAAAGTTA TTTTATCTGA AGAGGGATAT
AATCCAATTA AAAGAAGTGA TAGCTTCTGT AATTTGCATG ATCTGCATAT ATATGGGGAT CAATATG

Locus: Os02g0204201

Loading...

Locus: Os02g0204201

Loading...