Os02t0314400-01

Locus

Os02g0314400

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

Transcript Evidence

AK069918 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

J023039A19 (Online Clone Ordering)

Expression Databases

TENOR (Os02t0314400-01)

Transcript

1981 bp

>Os02t0314400-01 Non-protein coding transcript.
ATAGGCCATCCAGACTATCTTGACATATGTCCGTAGCCCAGCTCTCTCCTCGCTTATCTC
TGATCCTTCTCCTACCTGCTGCCCCCAGGTAATGTGTCTGCACATTCTTTGTGTGTGTAC
ATGAAGTTTGAGAGGCGTTTTGCTCAAGACCGCGCAACGATTCCATATGACACCGCATCG
TTGTCCATGCCTATCATGTTCATCCAGAGCCCCTGTTGATCTTCAGATAAGAGAAAAGCT
CAAAATTAAAGAAGGCTTGTTTATTGATCATGTCAAGGATAGGTATCGACGGCGATGCGC
TGGCTATGGCCATGGTTGTGCGGTTCTTGCGCAATAACGTTTTGATCTCGATCTCCTCTC
CTCTCTCCAAAGTTTTTCTTTCTTTACTCCTCTGATGGAACAATGCATGCATTTACTGAG
TTTTTGTCTCCTGTTCTTCCTCGTCTGCATGTTCTTGAATGGTTTGGTCGCTCTTATTCT
TCTGTGATTTCCTTGTCCATCATTATCTCAGGGCATGCATGAAAGCTCTATAAATTAAGA
TGGAACCTTTTCTTTTAGTTTTGTTGATGATGACTAATTTGGTTTGTTGCTAGCTACTAG
CTGTTGTTTCCTGTCTGAAAACTATGAAGCTATCTTGTAAGGTAGGTAAGACGAATGCGG
AGGTTCTTACTACTTCGGCCCTTGCCTAGAGCTTCAGAAATATAAACTAAGATTACCATG
AAGAACAGGTGTGTGCAACTTTATTTATGGTATTGATGAAAACTCAATCTAGTAAACATC
ATGTATGATCCAGTAGATCGATCGATTAGATTCATCGTACCTGAATCTATTTTTGCTTAC
CGTACTGTAGCTAGTCTTTCACCTTCAGTCTTTGCAAGTTATATTTTTTTATACTAGGTT
TCGTTCTTGCATACTTGCAAATGCTCTTGTAATTGAGTTTTCAGAGTTCTCCACTTGCAA
TAACAAATATTTTGGTTGTCTTTCCATGAAGCAGATCAGATGGCTAGATAGATGGTAAAT
GATCTGAAAAATATAAAAGAAGATTACAGGCACTGTTTGACAATACTTAACTGAATCTAT
ATGCAACTTATCTTTCAGTACATTGCACTGGAATTTGCCATTTGCTAGCACTTGCTGCCT
ATCTGTAGTGCTTATGGGATTCATGTCAGAACTAACTACTACCTGTATTTTGTAGGTTTA
AGAGTGTAAATTATTGGTCCCCTTCTTGCATTTTCTCTCAATTTATTCAGcatccagagt
gctataaattcacatcatcaattcatcatctccaatataatgcagctgcaagTTTCATAC
ATGGATGTGGCTTGTTTCCGACATCGCAGAGACAAATACCCAGTGTTCTAGATTCCAGAA
ATGTTATCAGTGACAATGTGTGTTCAGGCTAGGTGCCAAAGGAAGTACAGATAAGCTACA
GTACATCAGGAATGAGAGGAGTGCATCAAAATACTGAAGACCATGATGGATATTTCGAAA
TTGCAAATGAGGGGTGGCCGGTCTGTAAAAACAGTTTTCTCCTAAAAGATCGACATTGCT
CAAGCGACCTTAATCTAGAAAATAATTTCAAAGGAAACTAGGAATCATGGCATGGATCAA
TGAGGAGGCACTTTCTAAGCCAAGTGATCAAGTCAAGGTGCAAACTTATCACGAAGGTCT
TTCAGAACTCATTCGAAGTGTTTTTGCGGCCTGCAATCCTAATCGGCCAATAACACATAC
GCCTTCTGGCCAAACTCCTCTACCCTTACTCTCATAAATAGgagctaaccttcatatgag
gtcaatgtaccaaggaaaggttgataacaatcaaaatcgaaaggatggagtaacgattgc
gtgagtgctagtcctcagaattaattggCCAGACCATCAAACATTGTTCCTCATTGATTG
GTAGTAATTAATTGTCTAGACATTGTGGAATGATGGGAAGGTATCTAGCTTTTTCTCTAT
G

FASTA

>Os02t0314400-01 class=Sequence position=chr02:12450783..12453989 (+ strand)
ATAGGCCATC CAGACTATCT TGACATATGT CCGTAGCCCA GCTCTCTCCT CGCTTATCTC TGATCCTTCT CCTACCTGCT
GCCCCCAGGT AATGTGTCTG CACATTCTTT GTGTGTGTAC ATGAAGTTTG AGAGGCGTTT TGCTCAAGAC CGCGCAACGA
TTCCATATGA CACCGCATCG TTGTCCATGC CTATCATGTT CATCCAGAGC CCCTGTTGAT CTTCAGATAA GAGAAAAGCT
CAAAATTAAA GAAGGCTTGT TTATTGATCA TGTCAAGGAT AGGTATCGAC GGCGATGCGC TGGCTATGGC CATGGTTGTG
CGGTTCTTGC GCAATAACGT TTTGATCTCG ATCTCCTCTC CTCTCTCCAA AGTTTTTCTT TCTTTACTCC TCTGATGGAA
CAATGCATGC ATTTACTGAG TTTTTGTCTC CTGTTCTTCC TCGTCTGCAT GTTCTTGAAT GGTTTGGTCG CTCTTATTCT
TCTGTGATTT CCTTGTCCAT CATTATCTCA GGGCATGCAT GAAAGCTCTA TAAATTAAGA TGGAACCTTT TCTTTTAGTT
TTGTTGATGA TGACTAATTT GGTTTGTTGC TAGCTACTAG CTGTTGTTTC CTGTCTGAAA ACTATGAAGC TATCTTGTAA
GGTAGGTAAG ACGAATGCGG AGGTTCTTAC TACTTCGGCC CTTGCCTAGA GCTTCAGAAA TATAAACTAA GATTACCATG
AAGAACAGGT GTGTGCAACT TTATTTATGG TATTGATGAA AACTCAATCT AGTAAACATC ATGTATGATC CAGTAGATCG
ATCGATTAGA TTCATCGTAC CTGAATCTAT TTTTGCTTAC CGTACTGTAG CTAGTCTTTC ACCTTCAGTC TTTGCAAGTT
ATATTTTTTT ATACTAGGTT TCGTTCTTGC ATACTTGCAA ATGCTCTTGT AATTGAGTTT TCAGAGTTCT CCACTTGCAA
TAACAAATAT TTTGGTTGTC TTTCCATGAA GCAGATCAGA TGGCTAGATA GATGGTAAAT GATCTGAAAA ATATAAAAGA
AGATTACAGG CACTGTTTGA CAATACTTAA CTGAATCTAT ATGCAACTTA TCTTTCAGTA CATTGCACTG GAATTTGCCA
TTTGCTAGCA CTTGCTGCCT ATCTGTAGTG CTTATGGGAT TCATGTCAGA ACTAACTACT ACCTGTATTT TGTAGGTTTA
AGAGTGTAAA TTATTGGTCC CCTTCTTGCA TTTTCTCTCA ATTTATTCAG GTAACAAACG CTTGCAAGTC TGCTATTTTA
AGCATTGCAA GCAGTACTAG TACTATATAT ATACATGCTC CGCTAATGGT CAGGCAACAG AAGACCAAAC ATTGTACTAG
GCCAGCCATC TCGTTACATA CTTACATCAA TGTTTGCACT GTGATGTGAC TCTTGATGCA TTATTTGCTC GATCATATAT
ATGTAAAATA TAGCCAGTTC TCATGCATAA TTCATGTGAG AAGATCGAGC AAGAGTGGTC GAGCCGTCCA AGAAGACATT
ATAAAACCac aaaagttcca acatattgat cattgattgc tgctgtccta cagcatccag agtgctataa attcacatca
tcaattcatc atctccaata taatgcagct gcaagTTTCA TACATGGATG TGGCTTGTTT CCGACATCGC AGAGGTTAAC
TTCTTGTTGC TATCCTCCAT TATCTATTAA AAAAAAAATC TTGTTACTAT CCTGATGGTC AGAGTTGCCT GATGATCGAT
TGATGTCTTT TTGGGGGTCT CTCCATGGAA TTGCACAGAC AAATACCCAG TGTTCTAGAT TCCAGAAATG TTATCAGTGA
CAATGTGTGT TCAGGCTAGG TGCCAAAGGA AGTACAGGTA CCCCATCTGT TGACTCTTGT GCTAGCAGCG TGCAAGCAAG
CAGACAATCA TGCATATGGT CTCAGTAATT GCATATGAGT GATGTAGGAC ATGGTGTTTA CTCCCCTGAA TGCAGGCCCG
GCCTTGATCA GGGGCTAATT AACATTACTT AGTGCAATCT TTGCTCTGTT TTGTAATTAC ATTGATGTGC CAGATAAGCT
ACAGTACATC AGGAATGAGA GGAGTGCATC AAAATACTGA AGACCATGAT GGATATTTCG AAATTGCAAA TGAGGGGTGG
CCGGTCTGTA AAAACAGTTT TCTCCTAAAA GATCGACATT GCTCAAGCGA CCTTAATCTA GAAAATAATT TCAAAGGTAC
TTCAGAATGG TCAAAGCTCA GTTCTGCGAT AGACATTGTC ATAGACATTT GGATGCATGT GTCATGGAAG TGCTTATACT
ATTAATATGA ACATGTATTT TGGTTTTTTT TTAAAAAAAA AAAACTGGCA CATGATTGTC AATTTTGCCT AGCGATAGCA
AAATAGGTGT GTGAAGTTTA AACATAGTAA ACCATGACTT TATCAACCCA CTCAAATCAT GCTCCTTATG AAAAGTTCTA
GATGAGAAAA ATTTTAGGTT TGGGAGTGTC TAGATTGAAA TTTTTAGTCG TTTTTCTACC CACTTGGATG TCAATCCAAT
GGTTCTCATC ACTCCCACTA TCATTCTTTC TTAGGTATAT ATAAATATAT TGTTTGTAGG AAACTAGGAA TCATGGCATG
GATCAATGAG GAGGCACTTT CTAAGCCAAG TGATCAAGTC AAGGTGCAAA CTTATCACGA AGGGTATGTA TTCTAGCTCT
TCTTCCTCCG AACATACAAG CATAACTTAA AATGGAATCT TATTGAGGAG TACTTTTATA TTTACTGAAC TTGGGTTGTA
GTCTTTCAGA ACTCATTCGA AGTGTTTTTG CGGCCTGCAA TCCTAATCGG CCAATAACAC ATACGCCTTC TGGCCAAACT
CCTCTACCCT TACTCTCATA AATAGGTAAC CATAATCCCT TAACGTTCAC ATTAAAACCC CAAATTTATG atattgatct
agtgtccttt ccatgttctc ttgcatcttt ctttcattgt cttgtaggag ctaaccttca tatgaggtca atgtaccaag
gaaaggttga taacaatcaa aatcgaaagg atggagtaac gattgcgtga gtgctagtcc tcagaattaa ttggCCAGAC
CATCAAACAT TGTTCCTCAT TGATTGGTAG TAATTAATTG TCTAGACATT GTGGAATGAT GGGAAGGTAT CTAGCTTTTT
CTCTATG

Locus: Os02g0314400

Loading...

Locus: Os02g0314400

Loading...