Os02t0723400-01

Locus

Os02g0723400

Description

Similar to Isoform 2 of Auxin-responsive protein IAA8.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

IAA8

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsIAA8

Oryzabase Gene Name Synonym(s)

Aux/IAA protein 8, INDOLE-3-ACETIC ACID INDUCIBLE 8-LIKE

Transcript Evidence

AK108275 (DDBJ, Best hit)

Protein Evidence

Q6Z5M0-2 (UniProt)

Literature

Note

Manual Curation

Full-length cDNA

002-141-C07 (Online Clone Ordering)

Expression Databases

TENOR (Os02t0723400-01)

RiceXPro (AK108275)

Others

Oryzabase (10899)

KEGG (Os02t0723400-01)

Transcript

716 bp

>Os02t0723400-01 Similar to Isoform 2 of Auxin-responsive protein IAA8.
AACATACGTACCAGCTGAATAGCTGATGGCGGTGCAACCACTAAAACACCGTACCCATCT
CTCTCTCTCTTTCTCTCTATAAATTTGACACAATAAAAAGAGGGGTCATCGTTGGGTGCT
CCTCATTTCTCTAGTGATCTTCTTTTTCTTTTCTTTTGTTTTCTGTCTCTAGCGAACTAC
TAGTTCTTGGATCCGATCGACCGACCCTACCACCCTTGATTTCATGGAGTGCATGGCGAG
TACTGAAGAGTCTCTCCCAGCTTCTTCCTCCATGGATAGTTGCAGCGGCGAACTGCCGAc
gacgacgacgacggcgccggcgcaatccacggcgtcttccggctgccgaccgccggcgac
ggcggcgAAGCGGCGGAGTCTGATCAGCACAGATCTTCGCCTCGGGCTCACCCTCTCCTC
CGTCGTCCACATCGACGGCAACAACCCTTCTACCCCAAGGCAAGATTTCGATCTCTGATC
ATTCTGCACACCTACTGCTTTAATTTCAGAGAAATTTTAAGATACTTGAGAAGGTATTCG
ATACATAGTCGTAAGAAGTTTGCTTTCGGTCTTTTCGGTTTTCGTTtttttttcctccct
tgttccctggcaatggccattcgaccggttgcatcgtgtaattgaaatcttgccttttct
aatatattgacatgtaactcttttgcgcattcgtgaaaaaaagaAACATGTTAAAG

CDS

255 bp

>Os02t0723400-01 Similar to Isoform 2 of Auxin-responsive protein IAA8.
ATGGAGTGCATGGCGAGTACTGAAGAGTCTCTCCCAGCTTCTTCCTCCATGGATAGTTGC
AGCGGCGAACTGCCGAcgacgacgacgacggcgccggcgcaatccacggcgtcttccggc
tgccgaccgccggcgacggcggcgAAGCGGCGGAGTCTGATCAGCACAGATCTTCGCCTC
GGGCTCACCCTCTCCTCCGTCGTCCACATCGACGGCAACAACCCTTCTACCCCAAGGCAA
GATTTCGATCTCTGA

Protein

85 aa

>Os02t0723400-01 Similar to Isoform 2 of Auxin-responsive protein IAA8.
MECMASTEESLPASSSMDSCSGELPTTTTTAPAQSTASSGCRPPATAAKRRSLISTDLRL
GLTLSSVVHIDGNNPSTPRQDFDL*

5'UTR

chr02:30064358..30064580 (+ strand) : 223 bp

CDS

chr02:30064581..30064835 (+ strand) : 255 bp

3'UTR

chr02:30064836..30065073 (+ strand) : 238 bp

FASTA

>Os02t0723400-01 class=Sequence position=chr02:30064358..30065073 (+ strand)
AACATACGTA CCAGCTGAAT AGCTGATGGC GGTGCAACCA CTAAAACACC GTACCCATCT CTCTCTCTCT TTCTCTCTAT
AAATTTGACA CAATAAAAAG AGGGGTCATC GTTGGGTGCT CCTCATTTCT CTAGTGATCT TCTTTTTCTT TTCTTTTGTT
TTCTGTCTCT AGCGAACTAC TAGTTCTTGG ATCCGATCGA CCGACCCTAC CACCCTTGAT TTCATGGAGT GCATGGCGAG
TACTGAAGAG TCTCTCCCAG CTTCTTCCTC CATGGATAGT TGCAGCGGCG AACTGCCGAc gacgacgacg acggcgccgg
cgcaatccac ggcgtcttcc ggctgccgac cgccggcgac ggcggcgAAG CGGCGGAGTC TGATCAGCAC AGATCTTCGC
CTCGGGCTCA CCCTCTCCTC CGTCGTCCAC ATCGACGGCA ACAACCCTTC TACCCCAAGG CAAGATTTCG ATCTCTGATC
ATTCTGCACA CCTACTGCTT TAATTTCAGA GAAATTTTAA GATACTTGAG AAGGTATTCG ATACATAGTC GTAAGAAGTT
TGCTTTCGGT CTTTTCGGTT TTCGTTtttt tttcctccct tgttccctgg caatggccat tcgaccggtt gcatcgtgta
attgaaatct tgccttttct aatatattga catgtaactc ttttgcgcat tcgtgaaaaa aagaAACATG TTAAAG

Locus: Os02g0723400

Loading...

Locus: Os02g0723400

Loading...