Os03t0177900-03

Locus

Os03g0177900

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

RFA3

CGSNL Gene Name

ELONGATION FACTOR 1A3

Oryzabase Gene Symbol Synonym(s)

rfa3*, REFA3, refa3

Oryzabase Gene Name Synonym(s)

rice elongation factor 1A (eEFIA)-3, rice elongation factor 1A-3, ELONGATION FACTOR 1A, Elongation factor 1-alpha, EF-1-alpha

Transcript Evidence

AK058454 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-015-H06 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0177900-03)

Others

Oryzabase (2071)

Transcript

205 bp

>Os03t0177900-03 Non-protein coding transcript.
TTAATACTCGTTTATTTCTGTTCGGTTAAAACTGATGCTCTGAGTCCGATTATTGTCCAT
CGGCTGTTTTGGAATGCGAGTATTTACATTGCTACTTCCTGTGTCGTTATTTTCGTTTGT
GCTATTCCCTGCTTTTGCTGCTATTGATAACTGGAAACTGTCTCTGTCATTGAATCTCAG
ACAAGTTTTCTGCTATTGGAAACTG

FASTA

>Os03t0177900-03 class=Sequence position=chr03:4113497..4113701 (+ strand)
TTAATACTCG TTTATTTCTG TTCGGTTAAA ACTGATGCTC TGAGTCCGAT TATTGTCCAT CGGCTGTTTT GGAATGCGAG
TATTTACATT GCTACTTCCT GTGTCGTTAT TTTCGTTTGT GCTATTCCCT GCTTTTGCTG CTATTGATAA CTGGAAACTG
TCTCTGTCAT TGAATCTCAG ACAAGTTTTC TGCTATTGGA AACTG

Locus: Os03g0177900

Loading...

Locus: Os03g0177900

Loading...