Os03t0179950-00

Locus

Os03g0179950

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

Transcript Evidence

CT835230 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Expression Databases

TENOR (Os03t0179950-00)

Transcript

245 bp

>Os03t0179950-00 Non-protein coding transcript.
ATCCTACGCAGCCTTGTCCCTGCCTCTGCTCACCGGCGACGATCACCTCGCGCCCATTCA
GGGACCATGTTAGAAAACAACAGTGTTGTGGTGACAGACTTCTCAGATGATGATAGCAAT
TGTGAATGTTCTGTAAAAAAGGAAGAAGATTGTGAGAGTGTAAGAACGAGAGCAAAATGG
GCTTTTCAGCATCTATTCAGTTTGCAATGTTGAGGTGAAGGCAATGCCTTACTGATCTTG
CAATT

FASTA

>Os03t0179950-00 class=Sequence position=chr03:4193294..4193538 (+ strand)
ATCCTACGCA GCCTTGTCCC TGCCTCTGCT CACCGGCGAC GATCACCTCG CGCCCATTCA GGGACCATGT TAGAAAACAA
CAGTGTTGTG GTGACAGACT TCTCAGATGA TGATAGCAAT TGTGAATGTT CTGTAAAAAA GGAAGAAGAT TGTGAGAGTG
TAAGAACGAG AGCAAAATGG GCTTTTCAGC ATCTATTCAG TTTGCAATGT TGAGGTGAAG GCAATGCCTT ACTGATCTTG
CAATT