Os03t0390600-03

Locus

Os03g0390600

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

histone H3

Transcript Evidence

AK058285 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-013-D12 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0390600-03)

Others

Oryzabase (15761)

Transcript

307 bp

>Os03t0390600-03 Non-protein coding transcript.
AAGCATGCGTCGTAGTGTTAGTAGTGGGTTTTAATCTTTTGCTTATAAGAACAATCTGAG
TAGGGTGTATTTTGTGGAACAATATGTTTCTCATGATGGTGCTGTATTCGTCTTATTGGT
GGATCTGTCAAAAATACTCAGCATATTGTCAGTGTGTCTGGTGACTCTTATTTTGTTAGT
CTGATTCGTTTGCGTCTTATTCTAGCGGTGCTGCCTCTTTGGCACTGTGCATGGCTAGAT
ACAATTACATTGTAATTCACCTGTCTCTAATCCGTGTTAATGTAAGTGTTCCGTTGCTGT
CCGTGTG

FASTA

>Os03t0390600-03 class=Sequence position=chr03:15647845..15648151 (+ strand)
AAGCATGCGT CGTAGTGTTA GTAGTGGGTT TTAATCTTTT GCTTATAAGA ACAATCTGAG TAGGGTGTAT TTTGTGGAAC
AATATGTTTC TCATGATGGT GCTGTATTCG TCTTATTGGT GGATCTGTCA AAAATACTCA GCATATTGTC AGTGTGTCTG
GTGACTCTTA TTTTGTTAGT CTGATTCGTT TGCGTCTTAT TCTAGCGGTG CTGCCTCTTT GGCACTGTGC ATGGCTAGAT
ACAATTACAT TGTAATTCAC CTGTCTCTAA TCCGTGTTAA TGTAAGTGTT CCGTTGCTGT CCGTGTG