Os03t0648400-04

Locus

Os03g0648400

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsDjA4, YDJ1

Oryzabase Gene Name Synonym(s)

DnaJ domain protein A4, YDJ1 protein

Transcript Evidence

AK058555 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-017-D03 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0648400-04)

Others

Oryzabase (12141)

Transcript

249 bp

>Os03t0648400-04 Non-protein coding transcript.
GAAGCTGATTTTACACCCCTTAAGCCGGGACTGTATCCCTTTTGTTTGCGACTTAAAAAA
TGCTACTCGTATCTAGTAATAGCTGGCTACGTTTTACTATGCTGTGAGACTCGTAGAGTT
TTACCTCCTAAAAAGAAACTCGGTATGTTGTGAATGCTACAACTGACACTGCACCGTGTG
CAGTGGCTCAACATTTTTTGTGGTCAGATGGCTATGCTTGCACCGTGAGACTCGTAGAGT
TGTGCATCT

FASTA

>Os03t0648400-04 class=Sequence position=chr03:25130707..25130955 (+ strand)
GAAGCTGATT TTACACCCCT TAAGCCGGGA CTGTATCCCT TTTGTTTGCG ACTTAAAAAA TGCTACTCGT ATCTAGTAAT
AGCTGGCTAC GTTTTACTAT GCTGTGAGAC TCGTAGAGTT TTACCTCCTA AAAAGAAACT CGGTATGTTG TGAATGCTAC
AACTGACACT GCACCGTGTG CAGTGGCTCA ACATTTTTTG TGGTCAGATG GCTATGCTTG CACCGTGAGA CTCGTAGAGT
TGTGCATCT

Locus: Os03g0648400

Loading...

Locus: Os03g0648400

Loading...