Os03t0655400-01

Locus

Os03g0655400

Description

Similar to LIP5.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

LEA24

CGSNL Gene Name

LATE EMBRYOGENESIS ABUNDANT PROTEIN 24

Oryzabase Gene Symbol Synonym(s)

OsLEA24, WSI724

Oryzabase Gene Name Synonym(s)

late embryogenesis abundant protein 24, water stress-induced 724, WATER STRESS INDUCIBLE PROTEIN 724

Transcript Evidence

AK059150 (DDBJ, Best hit)

Protein Evidence

GeneMark

Literature

Note

Manual Curation

Full-length cDNA

001-023-B08 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0655400-01)

RiceXPro (AK059150)

Others

Oryzabase (10188)

KEGG (Os03t0655400-01)

Transcript

619 bp

>Os03t0655400-01 Similar to LIP5.
ACCACAGCTAGATCATTAGCAATCCATTCCGATCCATCAAATTTCTCTTGAGACCGTAGA
GAGAGAGAGAGGCGCCAACCATGGCCGGCATCATCCACAAGATCGAGGAGAAGCTCCACA
TGGGCGGAGGCGAGCACAAGAAGGAAGACGAGCACAAGAAGGAGGGGGAGCACCACAAGA
AGGACGGGGAGCACAAGGAAGGCGTGGTGGAGAAGATCAAGGACAAGATCACCGGCGACC
ACGGCGACGGCGGCGAGCACAAGGAGAAGAAGGACAAGAAGAAGAAGAAGGAGAAGAAGC
ACGGCGAGGAGGGCCACCACCACGACGGCCACAGCAGCAGCAGCAGCGACAGCGACTGAG
CCGCCGCGCCCCCACACCGGCGCCGTGCGTGCGTGCATGCAGGTGATGCTGCAGATGATT
GGAGGAGTTCGTAGCAGGATTAATTAGTATCTGTGCAATACGTGATGCAGTGATCTGTCT
CATGCATGTATCTGTGCTTGATTGCAAGAAAAAAAAAAGGCATGGTTTGCCTTTGTGATG
TACTGATAATAATGGCTGCACGGTGCCTTGTAATAAGAACGCTAATTATGATGAAATTGA
TGTGTATTATCCTGGCGTC

CDS

279 bp

>Os03t0655400-01 Similar to LIP5.
ATGGCCGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGAGGCGAGCACAAG
AAGGAAGACGAGCACAAGAAGGAGGGGGAGCACCACAAGAAGGACGGGGAGCACAAGGAA
GGCGTGGTGGAGAAGATCAAGGACAAGATCACCGGCGACCACGGCGACGGCGGCGAGCAC
AAGGAGAAGAAGGACAAGAAGAAGAAGAAGGAGAAGAAGCACGGCGAGGAGGGCCACCAC
CACGACGGCCACAGCAGCAGCAGCAGCGACAGCGACTGA

Protein

93 aa

>Os03t0655400-01 Similar to LIP5.
MAGIIHKIEEKLHMGGGEHKKEDEHKKEGEHHKKDGEHKEGVVEKIKDKITGDHGDGGEH
KEKKDKKKKKEKKHGEEGHHHDGHSSSSSDSD*

5'UTR

chr03:25563660..25563739 (+ strand) : 80 bp

CDS

chr03:25563740..25564018 (+ strand) : 279 bp

3'UTR

chr03:25564019..25564061 (+ strand) : 43 bp

chr03:25564215..25564431 (+ strand) : 217 bp

FASTA

>Os03t0655400-01 class=Sequence position=chr03:25563660..25564431 (+ strand)
ACCACAGCTA GATCATTAGC AATCCATTCC GATCCATCAA ATTTCTCTTG AGACCGTAGA GAGAGAGAGA GGCGCCAACC
ATGGCCGGCA TCATCCACAA GATCGAGGAG AAGCTCCACA TGGGCGGAGG CGAGCACAAG AAGGAAGACG AGCACAAGAA
GGAGGGGGAG CACCACAAGA AGGACGGGGA GCACAAGGAA GGCGTGGTGG AGAAGATCAA GGACAAGATC ACCGGCGACC
ACGGCGACGG CGGCGAGCAC AAGGAGAAGA AGGACAAGAA GAAGAAGAAG GAGAAGAAGC ACGGCGAGGA GGGCCACCAC
CACGACGGCC ACAGCAGCAG CAGCAGCGAC AGCGACTGAG CCGCCGCGCC CCCACACCGG CGCCGTGCGT GCGTGCATGC
AGGTAGTTGT TGTGCAAGAA ATTGAAGATA TCTTTCTTTT TTCTGTTTTG TTGCTTTGCT TTGTTGATTT TCTGGTTAGG
ATCTGAAAAT GTTGGCGTGT GACTGACATG ATGCTAATTA ATCTCTCTTG TGATAATATG TTTTTTGTTT TGCAGGTGAT
GCTGCAGATG ATTGGAGGAG TTCGTAGCAG GATTAATTAG TATCTGTGCA ATACGTGATG CAGTGATCTG TCTCATGCAT
GTATCTGTGC TTGATTGCAA GAAAAAAAAA AGGCATGGTT TGCCTTTGTG ATGTACTGAT AATAATGGCT GCACGGTGCC
TTGTAATAAG AACGCTAATT ATGATGAAAT TGATGTGTAT TATCCTGGCG TC