Os03t0737000-02

Locus

Os03g0737000

Description

Hypothetical gene.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsCBSX4, OsCBSX4a, OsCBSX4b, OsCBSX4c, OsCBSX4d, OsCBSX4e, OsCBSX4f

Oryzabase Gene Name Synonym(s)

cystathionine b-synthase domain containing protein OsCBSX4, CBS domain containing protein OsCBSX4

Transcript Evidence

AK100865 (DDBJ, Best hit)

Protein Evidence

longestORF

Literature

Note

Manual Curation

Full-length cDNA

J023124A15 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0737000-02)

RiceXPro (AK100865)

Others

Oryzabase (10321)

KEGG (Os03t0737000-02)

Transcript

1587 bp

>Os03t0737000-02 Hypothetical gene.
ACATCATACCAAGTGTCCTCCTTCCTCCTCATCCTCCCCAACCACTGCATCCGGGTCGGC
GTCCTCCTCCTCCTCCTCCTCCTCGCAGGTAAAGCAGCATCCAAGCATCCTTTCCAATCC
ATGCTCAGAGTTGGAAGTAGAGCTGCTGCTGATGATGGTGTGTGGATCGGTGCTGGTTGG
TTTCTCGTTCTTGCTTGAGTGTGAGATGTGATGTTGATGTGCGTGTGTGTGGAGTCTGGA
CTGGAAGGTTTCTTGAGTTCAGAGTGCAGATCAGAGAATCGTACTTTTGCTTTTTACAGT
GTGTTCTTGGTTTGCCCACACGATCTGTTCATCTTTTGTTTCTTTTGTTTTGCCTTTCAT
GAACAAACGACCACAGCTCTGCTTGCCTGCTACTGTCCTTCTCAGTTTGGCAAATGAAAG
GATATTTTTTTTAGGGAAAGAAAGCGAAAATTACTAGTGCTAGAAAGCAGTGGCAAGTGA
GAATAACACTTCTGCTTGATTGATTAGGTTAGGAGTTTATAGATAGTTCTTCCCTCTTGG
TACTGTCAGTCTGTCACTGGTGTGTAAGTAGAGTGACAGTGTTGATGTTCTTCCTTGAGA
TAAACGGCGATATCCTTTTATCACTTCCTGAGAGAGCACGGCACGCTTTACTCCCTTTTA
TTCTGGAAATATTGTTCTCTTCCATGGGTTACAGTTTGTGTTTCGATACAGCTTTGCTTG
CCATGATTTTTTTTCTGGCCACTTTTTTAGTTAGAGAAGCTAAAGAACTTACTTTTGGTT
TCGGGTTAGGCGTGCCGTAGATTCATATGCAATTCATGGTCCGCTTGTTTCTTTTGATTA
TTGAGCTTGAGTGATTCGGTAACATCACAACAGTACACCCACATATCATGGACACATCAA
GTGCGTGTAGTTTATTTAGTATTTAGTGTTTTGAGTGGAGACGGCAATAGCTGGATTCTG
TATTTGGTGGTGACTCCTTATTGGTTGATTGTGACCTAAATAAATATTATTGATTTGCTA
ACGAATGCTGGCAAACCTTTGCCCGTTTTTTCGCCTTGCACTTTCATGAACTAAATGATT
CTTGGAATCTAGGAGTATTAATTGGACAGACTCTTGGATTCTACTCTAGATCAATAAGGT
TGACTACATTGATAGGGGATTCCCTGTAGAATACTGTGCATCAAAATGAATACCGATTAA
TAGTCAATATGTAGACATGACCATTTCGCTGGTCATTCAACACATTTTGGTGCGTACATT
GCTTTGTTCTAGCAGTATTTTTGCTGACCAGTGTACAAAATGGTAGGCTAGAGCTATAAT
GCTTTACATCCTTTTCATTGCATCAGCGCAGTGGAAATTAACTTCCACTTGACATAATGC
TCCCAGGCCCCATCAGGATTGGTGTGGGGTTGTTTATTTATGTGGAATAGTTTGAGAACT
ATATTGTTTTTTAAGTAATTCCACTTGTACAGACTTTCTTGTTGCTTTCTTACCAGTCCT
TTATACTGAAACTGATTGTCCGGTCATTCTAGCAGTCACCTGCATTACAACGGAAATTGA
TTTGCAACAACTCTGTTTCGGACAAGC

CDS

216 bp

>Os03t0737000-02 Hypothetical gene.
ATGTTCTTCCTTGAGATAAACGGCGATATCCTTTTATCACTTCCTGAGAGAGCACGGCAC
GCTTTACTCCCTTTTATTCTGGAAATATTGTTCTCTTCCATGGGTTACAGTTTGTGTTTC
GATACAGCTTTGCTTGCCATGATTTTTTTTCTGGCCACTTTTTTAGTTAGAGAAGCTAAA
GAACTTACTTTTGGTTTCGGGTTAGGCGTGCCGTAG

Protein

72 aa

>Os03t0737000-02 Hypothetical gene.
MFFLEINGDILLSLPERARHALLPFILEILFSSMGYSLCFDTALLAMIFFLATFLVREAK
ELTFGFGLGVP*

5'UTR

chr03:30209796..30210379 (- strand) : 584 bp

CDS

chr03:30209580..30209795 (- strand) : 216 bp

3'UTR

chr03:30208793..30209579 (- strand) : 787 bp

FASTA

>Os03t0737000-02 class=Sequence position=chr03:30208793..30210379 (- strand)
ACATCATACC AAGTGTCCTC CTTCCTCCTC ATCCTCCCCA ACCACTGCAT CCGGGTCGGC GTCCTCCTCC TCCTCCTCCT
CCTCGCAGGT AAAGCAGCAT CCAAGCATCC TTTCCAATCC ATGCTCAGAG TTGGAAGTAG AGCTGCTGCT GATGATGGTG
TGTGGATCGG TGCTGGTTGG TTTCTCGTTC TTGCTTGAGT GTGAGATGTG ATGTTGATGT GCGTGTGTGT GGAGTCTGGA
CTGGAAGGTT TCTTGAGTTC AGAGTGCAGA TCAGAGAATC GTACTTTTGC TTTTTACAGT GTGTTCTTGG TTTGCCCACA
CGATCTGTTC ATCTTTTGTT TCTTTTGTTT TGCCTTTCAT GAACAAACGA CCACAGCTCT GCTTGCCTGC TACTGTCCTT
CTCAGTTTGG CAAATGAAAG GATATTTTTT TTAGGGAAAG AAAGCGAAAA TTACTAGTGC TAGAAAGCAG TGGCAAGTGA
GAATAACACT TCTGCTTGAT TGATTAGGTT AGGAGTTTAT AGATAGTTCT TCCCTCTTGG TACTGTCAGT CTGTCACTGG
TGTGTAAGTA GAGTGACAGT GTTGATGTTC TTCCTTGAGA TAAACGGCGA TATCCTTTTA TCACTTCCTG AGAGAGCACG
GCACGCTTTA CTCCCTTTTA TTCTGGAAAT ATTGTTCTCT TCCATGGGTT ACAGTTTGTG TTTCGATACA GCTTTGCTTG
CCATGATTTT TTTTCTGGCC ACTTTTTTAG TTAGAGAAGC TAAAGAACTT ACTTTTGGTT TCGGGTTAGG CGTGCCGTAG
ATTCATATGC AATTCATGGT CCGCTTGTTT CTTTTGATTA TTGAGCTTGA GTGATTCGGT AACATCACAA CAGTACACCC
ACATATCATG GACACATCAA GTGCGTGTAG TTTATTTAGT ATTTAGTGTT TTGAGTGGAG ACGGCAATAG CTGGATTCTG
TATTTGGTGG TGACTCCTTA TTGGTTGATT GTGACCTAAA TAAATATTAT TGATTTGCTA ACGAATGCTG GCAAACCTTT
GCCCGTTTTT TCGCCTTGCA CTTTCATGAA CTAAATGATT CTTGGAATCT AGGAGTATTA ATTGGACAGA CTCTTGGATT
CTACTCTAGA TCAATAAGGT TGACTACATT GATAGGGGAT TCCCTGTAGA ATACTGTGCA TCAAAATGAA TACCGATTAA
TAGTCAATAT GTAGACATGA CCATTTCGCT GGTCATTCAA CACATTTTGG TGCGTACATT GCTTTGTTCT AGCAGTATTT
TTGCTGACCA GTGTACAAAA TGGTAGGCTA GAGCTATAAT GCTTTACATC CTTTTCATTG CATCAGCGCA GTGGAAATTA
ACTTCCACTT GACATAATGC TCCCAGGCCC CATCAGGATT GGTGTGGGGT TGTTTATTTA TGTGGAATAG TTTGAGAACT
ATATTGTTTT TTAAGTAATT CCACTTGTAC AGACTTTCTT GTTGCTTTCT TACCAGTCCT TTATACTGAA ACTGATTGTC
CGGTCATTCT AGCAGTCACC TGCATTACAA CGGAAATTGA TTTGCAACAA CTCTGTTTCG GACAAGC

Locus: Os03g0737000

Loading...

Locus: Os03g0737000

Loading...