Os03t0780600-02

Locus

Os03g0780600

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

TUB7

CGSNL Gene Name

BETA-TUBULIN 7

Oryzabase Gene Symbol Synonym(s)

OsTUB7, TUBB7, pTUB22

Oryzabase Gene Name Synonym(s)

beta tubulin 7, Tubulin beta-7 chain, Beta-7-tubulin

Transcript Evidence

AK061888 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

  • CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

001-041-F12 (Online Clone Ordering)

Expression Databases

TENOR (Os03t0780600-02)

Others

Oryzabase (2962)

Transcript

397 bp

>Os03t0780600-02 Non-protein coding transcript.
TCTCGTCGCGGAGTACCAGCAGTACCAGGACGCCACAGCCGATGAAGAGTACGAAGACGA
AGAGGAAGAAGCTGAGGCCGAATAGCATTGAGCCCCATTTGCCCTTCACAGGTTGTTTTG
CCAGTGAAGAGTTTTGTGTCTTTGTGATGCTGTGCTCTTTTTTCTTTCTCTGACGTGCGT
GATGGATGTATGGGTGAGGTTTGCGTCCGTGCTTCGTTTTGTCACCTGTGCTGCGTAGCA
GGCTGCAGTCCCGTTTTGTAAGACGTCTCTGGTGGTCAGTAGCTGAAGGCTTGAAAAGTG
TTTTGAGTGCCCTCCTTGAGCTAAATCACCTGTAAGTTCTGACATGTATTGGTAGTGGTT
TTCTCATCTCTGTGAAGCTTCTGTGTAGTCTGTTACT

FASTA

>Os03t0780600-02 class=Sequence position=chr03:32374326..32374722 (+ strand)
TCTCGTCGCG GAGTACCAGC AGTACCAGGA CGCCACAGCC GATGAAGAGT ACGAAGACGA AGAGGAAGAA GCTGAGGCCG
AATAGCATTG AGCCCCATTT GCCCTTCACA GGTTGTTTTG CCAGTGAAGA GTTTTGTGTC TTTGTGATGC TGTGCTCTTT
TTTCTTTCTC TGACGTGCGT GATGGATGTA TGGGTGAGGT TTGCGTCCGT GCTTCGTTTT GTCACCTGTG CTGCGTAGCA
GGCTGCAGTC CCGTTTTGTA AGACGTCTCT GGTGGTCAGT AGCTGAAGGC TTGAAAAGTG TTTTGAGTGC CCTCCTTGAG
CTAAATCACC TGTAAGTTCT GACATGTATT GGTAGTGGTT TTCTCATCTC TGTGAAGCTT CTGTGTAGTC TGTTACT

Locus: Os03g0780600

Loading...

Locus: Os03g0780600

Loading...