Os04t0423600-03

Locus

Os04g0423600

Description

Similar to OSIGBa0076I14.4 protein.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsSET18, SDG738

Oryzabase Gene Name Synonym(s)

SET protein 18

Transcript Evidence

AK066084 (DDBJ, Best hit)

Protein Evidence

Q01L88 (UniProt)

Literature

Note

  • Exon-intron structures, exon and CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

J013051M03 (Online Clone Ordering)

Expression Databases

TENOR (Os04t0423600-03)

Others

Oryzabase (13383)

Transcript

1257 bp

>Os04t0423600-03 Similar to OSIGBa0076I14.4 protein.
ATAGTGCAACTAAGCATCTCCCTGATTTTTGTGTGCTCTCTTTTCATTTTAGAATGGCAG
ATGAGTATGATCGCAGCAGCTACAGAAGGTCTGGTGCTGATGACGAGGAAGGTGGCTACA
ACAAGACCAACACTGGAGATTATGGCCGCAGCGGTGACGACTACGGTCGTGACACTGGCC
TCTTCAACGAGTCCGGCAACGACGACAATGAGAGTGGCTACAAGAACACCAACACTGATG
AATATGGCAGCACTGGTAGCTACAACAAGTCCAACACCGACGACTTAACTGGCGGCTTCA
ACAAATCCGGCACAGATGACTACAGTGGTGGCGGCGGCTACAACAAATCTggcgccgacg
actacagcagcagcggtggctacagcaaatccggcactgacaactacagcgggagcggcg
gctacaacaaatccggcaacaatgactacagtggcagtggtggtggctacaacTAGTCCA
GCGCTGGCGACTATGGCAGCGAGTACAAGGATCCAGCACCGGCGACTATGGTCGTGGTGA
CGAATACAAGAAATCAAGCTCAGACGACTATGATGGTGGCTACAAGAAGTCAAGCAGCAA
CGATGATGGCTATGGCGGAAGCGGCTACAGCAAGCCGAGCACCGGCGACTACGACAGTGG
TAAGAACGCCTCCAACACTGATGGATATGGTGGCAGTGGCTACAACAAATCAAGCACAGA
CAACTCTGAGAGTGGCTACAACAAGTCCGGCACCGGTGAATATGGCAGCGGCGGCGGCTA
CAACAAATCAAGCACGGACAACTATGAGAGCGGCTACAACAAGTCCGGCACCGGCGACTA
TGGCAGCGGTGGTGGCTACGACAAGTCTGACGCCGGTGACTACACTGGTGGCTACAACAA
GTCGAGCACTGATGAGTACGCAACCGGAAGAGGCAAGACCAGTTCTGACGACTACTAGAT
AATTATCGCTTATCAGGAAAGCGAATCAGGGTACTCTTGATGCTGAAGTACTAAATATGC
TCGAATACAGTTGGTCCTTGCTAAAAAGGATTTCGTATGTATTCCCTCTTATTTACAGGA
TGGGTTGATCAGTTTGTCTCTGATATGCAAGGTTGATCACACATCTCAGAGGATGTGTGA
TGTGCGTAATATGCTCTGTATGTGTATGTACCTGAACGAAAATGTAATACTACTCTGCTA
TGTTTGCACATGAATAAAACGTGATATATGCAGTAGTATCAAGCAAGCGAATAGTTG

CDS

423 bp

>Os04t0423600-03 Similar to OSIGBa0076I14.4 protein.
ATGGCAGATGAGTATGATCGCAGCAGCTACAGAAGGTCTGGTGCTGATGACGAGGAAGGT
GGCTACAACAAGACCAACACTGGAGATTATGGCCGCAGCGGTGACGACTACGGTCGTGAC
ACTGGCCTCTTCAACGAGTCCGGCAACGACGACAATGAGAGTGGCTACAAGAACACCAAC
ACTGATGAATATGGCAGCACTGGTAGCTACAACAAGTCCAACACCGACGACTTAACTGGC
GGCTTCAACAAATCCGGCACAGATGACTACAGTGGTGGCGGCGGCTACAACAAATCTggc
gccgacgactacagcagcagcggtggctacagcaaatccggcactgacaactacagcggg
agcggcggctacaacaaatccggcaacaatgactacagtggcagtggtggtggctacaac
TAG

Protein

141 aa

>Os04t0423600-03 Similar to OSIGBa0076I14.4 protein.
MADEYDRSSYRRSGADDEEGGYNKTNTGDYGRSGDDYGRDTGLFNESGNDDNESGYKNTN
TDEYGSTGSYNKSNTDDLTGGFNKSGTDDYSGGGGYNKSGADDYSSSGGYSKSGTDNYSG
SGGYNKSGNNDYSGSGGGYN*

5'UTR

chr04:20942299..20942351 (- strand) : 53 bp

CDS

chr04:20941876..20942298 (- strand) : 423 bp

3'UTR

chr04:20941841..20941875 (- strand) : 35 bp

chr04:20941052..20941797 (- strand) : 746 bp

FASTA

>Os04t0423600-03 class=Sequence position=chr04:20941052..20942351 (- strand)
ATAGTGCAAC TAAGCATCTC CCTGATTTTT GTGTGCTCTC TTTTCATTTT AGAATGGCAG ATGAGTATGA TCGCAGCAGC
TACAGAAGGT CTGGTGCTGA TGACGAGGAA GGTGGCTACA ACAAGACCAA CACTGGAGAT TATGGCCGCA GCGGTGACGA
CTACGGTCGT GACACTGGCC TCTTCAACGA GTCCGGCAAC GACGACAATG AGAGTGGCTA CAAGAACACC AACACTGATG
AATATGGCAG CACTGGTAGC TACAACAAGT CCAACACCGA CGACTTAACT GGCGGCTTCA ACAAATCCGG CACAGATGAC
TACAGTGGTG GCGGCGGCTA CAACAAATCT ggcgccgacg actacagcag cagcggtggc tacagcaaat ccggcactga
caactacagc gggagcggcg gctacaacaa atccggcaac aatgactaca gtggcagtgg tggtggctac aacTAGTCCA
GCGCTGGCGA CTATGGCAGC GAGTACAAGG ACTCCAGCAC CGTCGACTAT GTCGTGTCTG GCGATTACAA GGACTCCAGC
ACCGGCGACT ATGGTCGTGG TGACGAATAC AAGAAATCAA GCTCAGACGA CTATGATGGT GGCTACAAGA AGTCAAGCAG
CAACGATGAT GGCTATGGCG GAAGCGGCTA CAGCAAGCCG AGCACCGGCG ACTACGACAG TGGTAAGAAC GCCTCCAACA
CTGATGGATA TGGTGGCAGT GGCTACAACA AATCAAGCAC AGACAACTCT GAGAGTGGCT ACAACAAGTC CGGCACCGGT
GAATATGGCA GCGGCGGCGG CTACAACAAA TCAAGCACGG ACAACTATGA GAGCGGCTAC AACAAGTCCG GCACCGGCGA
CTATGGCAGC GGTGGTGGCT ACGACAAGTC TGACGCCGGT GACTACACTG GTGGCTACAA CAAGTCGAGC ACTGATGAGT
ACGCAACCGG AAGAGGCAAG ACCAGTTCTG ACGACTACTA GATAATTATC GCTTATCAGG AAAGCGAATC AGGGTACTCT
TGATGCTGAA GTACTAAATA TGCTCGAATA CAGTTGGTCC TTGCTAAAAA GGATTTCGTA TGTATTCCCT CTTATTTACA
GGATGGGTTG ATCAGTTTGT CTCTGATATG CAAGGTTGAT CACACATCTC AGAGGATGTG TGATGTGCGT AATATGCTCT
GTATGTGTAT GTACCTGAAC GAAAATGTAA TACTACTCTG CTATGTTTGC ACATGAATAA AACGTGATAT ATGCAGTAGT
ATCAAGCAAG CGAATAGTTG 

Locus: Os04g0423600

Loading...

Locus: Os04g0423600

Loading...