Os04t0623901-01

Locus

Os04g0623901

Description

Primary microRNA of osa-miR171c; Target gene(s): OsHAM transcription factors (Os02g0662700, Os02g0663100, Os04g0555000, Os06g0105350), Control of floral transition, Maintenance of SAM indeterminacy

RAP-DB Gene Symbol Synonym(s)

osa-miR171c

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

MIR171C

CGSNL Gene Name

MICRORNA171C

Oryzabase Gene Symbol Synonym(s)

miR171c, osa-miR171cosa-miR171c-3p osa-miR171c-5p

Oryzabase Gene Name Synonym(s)

MICRORNA171c, osa-miRNA171c, delayed heading

Transcript Evidence

AK242153

Protein Evidence

NONE

Literature

PMID: 26023934

Note

Manual Curation

December 26, 2017

Full-length cDNA

J075153O10 (Online Clone Ordering)

Expression Databases

TENOR (Os04t0623901-01)

Others

Oryzabase (12621)

Transcript

1743 bp

>Os04t0623901-01 Primary microRNA of osa-miR171c; Target gene(s): OsHAM transcription factors (Os02g0662700, Os02g0663100, Os04g0555000, Os06g0105350), Control of floral transition, Maintenance of SAM indeterminacy
ATGTTGTGCTTTTGCTCCTAGCTAAGCTCTCCTCGTCTTCTTCTTCTTCTTCTTCTTCTT
CTCATCTACAACTACCTCTCCCTCACTTTTGCATTGCCTCCAAGAAGCCATATTAAAGGA
TCCTACGACTCCTTCCTCTCCCTCCTGCTCCTCCTCTTCTCATCTCCTTCACTTCTGCTT
CTGCATGAAACCAAGAAAAAAAAACTAGTTGCTTACTTGCTTTGCATAGTTAGCTAGCTG
TTGTGTTTCTCTGATCCCATGTCCTCATGAACTCTTGTTTGATCCTAGTGAGGTGAGAGT
ACTTGAGAGGGAGTGTATTGATTGGATTGCTGTTTTTATCTCTGATGATTTGCCTTGTTT
TGCTGATCTGAATGCTGATCGTTGGGGGATTGTTCTGCTCTCTATGTGGGAACGGGATAT
TGGTGCGGTTCAATCAGAAAGCTTGTGCTCCGAAGGCGAGGGGCTCCACTCTTTGATTGA
GCCGTGCCAATATCACGTCGCCTTTGCAGCTGCTCGTTTGTTTATGTAAGGATGTTTTTT
TCATTATTTCTTTTAATCCGTTTAGATCTTTCCCTGTCAGGTTTATGGTTTTGTACTCGT
TTATTATGAGTTCAACAATGTGATAGAGACCTTCTTTTTCTGGTTTTCAGAGGAACTGAT
GCTAGATGTTTATGAACTGTTTTCTATCCATGTACTGTTAGTACGTAGGAGTAAATTAAG
AAACTGTTGCTGTTACGCATGTGCTCATCCTTCTCTGATTTGTTAATTTGATACTCCCTC
TTGTCAGATAAGTTAGTTCTTGATTTCATGCTACTAGCAAACTGCAGCCTCTCAGACTAA
GTTCTGTTGACATGATTCATTTTAAAGCTTGTCGATCCGTCATTAGTTATTCAGATTTTA
CAGTCGCATAATTTTTCTAGTGTTTACATGCATGGTGTGGCTGAAAAGAAGTGTAGTTCA
GTAATATCTGATTACATTCTTCAGGTATATCTGATGTGATATTTAGGTacttcctctgtt
tcacaatgtaagatttgattttctagcattccccatattcatttagatgttaatgaatct
agacatatgtatgtgtttgattcattaatatctatatgtatgtggacaatgctagaaagt
tttacattgtaaaacggagggaataGCAATGTCGATGCAGTATATATACCCCTATCTGAT
TATACGATGAAATTGAGGAATAACCTTGTGGCCCTGTAGTTTATTATATTTCCCACTTCC
ATCCAATTCATACGACAAAGTTGTTGCTGCTTTTCCAGCTGCTTTTTTGGCACAAAAGCG
CAGTGAACACACTTTAAACTTAGCTAAGCTCTCAGTGTAGCAATCGTCTCATGCGGAACG
GCATAAAAGGCAATGTTGAGAGTGCACGTAAGATCGATTAGAAGGATCAAAAGATAGTAG
TAGAGACAAAAGAGTGCATGACCATTGTTCTGTGTGCTACATAGTATTTGCAGTGTCTGA
ACTTGAAAAGCTGATCACAAGTGCCCAAAGGGAGACAGACAGACAGATCCACATCGATCG
CAAGTCTTTGCCTACGATAAAGATCTTAGTAAGCTTGGAAGAGAGCTTGCAGAAAGAGCA
TCTCAAAAGGACGTACAATTGGAGCAAGCGAGCTTTTCATGTCGCCATCTTTTTCTGACC
TTCATTTGTAAAGAAGTACTGTAATTTTCTAGTGTAATAATGACAATGCAAATCCCATTA
TAT

FASTA

>Os04t0623901-01 class=Sequence position=chr04:31712233..31713975 (- strand)
ATGTTGTGCT TTTGCTCCTA GCTAAGCTCT CCTCGTCTTC TTCTTCTTCT TCTTCTTCTT CTCATCTACA ACTACCTCTC
CCTCACTTTT GCATTGCCTC CAAGAAGCCA TATTAAAGGA TCCTACGACT CCTTCCTCTC CCTCCTGCTC CTCCTCTTCT
CATCTCCTTC ACTTCTGCTT CTGCATGAAA CCAAGAAAAA AAAACTAGTT GCTTACTTGC TTTGCATAGT TAGCTAGCTG
TTGTGTTTCT CTGATCCCAT GTCCTCATGA ACTCTTGTTT GATCCTAGTG AGGTGAGAGT ACTTGAGAGG GAGTGTATTG
ATTGGATTGC TGTTTTTATC TCTGATGATT TGCCTTGTTT TGCTGATCTG AATGCTGATC GTTGGGGGAT TGTTCTGCTC
TCTATGTGGG AACGGGATAT TGGTGCGGTT CAATCAGAAA GCTTGTGCTC CGAAGGCGAG GGGCTCCACT CTTTGATTGA
GCCGTGCCAA TATCACGTCG CCTTTGCAGC TGCTCGTTTG TTTATGTAAG GATGTTTTTT TCATTATTTC TTTTAATCCG
TTTAGATCTT TCCCTGTCAG GTTTATGGTT TTGTACTCGT TTATTATGAG TTCAACAATG TGATAGAGAC CTTCTTTTTC
TGGTTTTCAG AGGAACTGAT GCTAGATGTT TATGAACTGT TTTCTATCCA TGTACTGTTA GTACGTAGGA GTAAATTAAG
AAACTGTTGC TGTTACGCAT GTGCTCATCC TTCTCTGATT TGTTAATTTG ATACTCCCTC TTGTCAGATA AGTTAGTTCT
TGATTTCATG CTACTAGCAA ACTGCAGCCT CTCAGACTAA GTTCTGTTGA CATGATTCAT TTTAAAGCTT GTCGATCCGT
CATTAGTTAT TCAGATTTTA CAGTCGCATA ATTTTTCTAG TGTTTACATG CATGGTGTGG CTGAAAAGAA GTGTAGTTCA
GTAATATCTG ATTACATTCT TCAGGTATAT CTGATGTGAT ATTTAGGTac ttcctctgtt tcacaatgta agatttgatt
ttctagcatt ccccatattc atttagatgt taatgaatct agacatatgt atgtgtttga ttcattaata tctatatgta
tgtggacaat gctagaaagt tttacattgt aaaacggagg gaataGCAAT GTCGATGCAG TATATATACC CCTATCTGAT
TATACGATGA AATTGAGGAA TAACCTTGTG GCCCTGTAGT TTATTATATT TCCCACTTCC ATCCAATTCA TACGACAAAG
TTGTTGCTGC TTTTCCAGCT GCTTTTTTGG CACAAAAGCG CAGTGAACAC ACTTTAAACT TAGCTAAGCT CTCAGTGTAG
CAATCGTCTC ATGCGGAACG GCATAAAAGG CAATGTTGAG AGTGCACGTA AGATCGATTA GAAGGATCAA AAGATAGTAG
TAGAGACAAA AGAGTGCATG ACCATTGTTC TGTGTGCTAC ATAGTATTTG CAGTGTCTGA ACTTGAAAAG CTGATCACAA
GTGCCCAAAG GGAGACAGAC AGACAGATCC ACATCGATCG CAAGTCTTTG CCTACGATAA AGATCTTAGT AAGCTTGGAA
GAGAGCTTGC AGAAAGAGCA TCTCAAAAGG ACGTACAATT GGAGCAAGCG AGCTTTTCAT GTCGCCATCT TTTTCTGACC
TTCATTTGTA AAGAAGTACT GTAATTTTCT AGTGTAATAA TGACAATGCA AATCCCATTA TAT

Locus: Os04g0623901

Loading...

Locus: Os04g0623901

Loading...