Os05t0419200-03

Locus

Os05g0419200

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

RUS6B

CGSNL Gene Name

ROOT UV-B SENSITIVE 6B

Oryzabase Gene Symbol Synonym(s)

OsRUS6B

Oryzabase Gene Name Synonym(s)

Transcript Evidence

AK058398 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-015-B03 (Online Clone Ordering)

Expression Databases

TENOR (Os05t0419200-03)

Others

Oryzabase (21452)

Transcript

430 bp

>Os05t0419200-03 Non-protein coding transcript.
GAATGGATGGTACAATTTTTTTTCATACATCGAATTCGGGCCCTATGTGAGTCAGCGAAC
TTCTTTAACTAAATCAACCATATCGAAGTGAAGTACCTGGCATGCACCGCGCGAGACAGG
ATGGATGGGTACTTCAACTTTGGAGCGATGTGCAACATCATGGGGTATGCTGACTCATGG
AAAGACGGGGAAGGAAGGAGAAACTAACCAAAAAAAATACTGGACTAACAAGCTTCTTGT
ATATCTATCTCACTATCTGTATTTAGTACTCTGTATAATGAGACGGGTATCCGCCATATA
GTCGTCGGTGTATGTATTGACCGACCTAGTTTTTGTTTCGACTCTACTTTCATTGTTTCG
GCTAACTTCGCGAATCTGTTGGTGTTTGTAAATGCCAGTTTTTCCATAAAGAAGAGCTCT
GTTTGTTTCC

FASTA

>Os05t0419200-03 class=Sequence position=chr05:20548402..20548922 (- strand)
GAATGGATGG TACAATTTTT TTTCATACAT CGAATTCGGG CCCTATGTGA GTCAGCGAAC TTCTTTAACT AAATCAACCA
TATCGAAGTG AAGTACCTGG CATGCACCGC GCGAGACAGG ATGGATGGGT ACTTCAACTT TGGTTAGTGC TCTCTTGATG
TGAAACTATG AACATTGTTA CCGAACCGTT AAGCATATTT TTCTTACTCG TTTTATTTAT ACCTGTTCTG CAGGAGCGAT
GTGCAACATC ATGGGGTATG CTGACTCATG GAAAGACGGG GAAGGAAGGA GAAACTAACC AAAAAAAATA CTGGACTAAC
AAGCTTCTTG TATATCTATC TCACTATCTG TATTTAGTAC TCTGTATAAT GAGACGGGTA TCCGCCATAT AGTCGTCGGT
GTATGTATTG ACCGACCTAG TTTTTGTTTC GACTCTACTT TCATTGTTTC GGCTAACTTC GCGAATCTGT TGGTGTTTGT
AAATGCCAGT TTTTCCATAA AGAAGAGCTC TGTTTGTTTC C

Locus: Os05g0419200

Loading...

Locus: Os05g0419200

Loading...