Os06t0187000-01

Locus

Os06g0187000

Description

Similar to Origin recognition complex 1.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

ORC1

CGSNL Gene Name

ORIGIN RECOGNITION COMPLEX 1

Oryzabase Gene Symbol Synonym(s)

OsORC1

Oryzabase Gene Name Synonym(s)

Transcript Evidence

AK103068 (DDBJ, Best hit)

Protein Evidence

Q9MB44 (UniProt)

Literature

Note

  • CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

J033117P13 (Online Clone Ordering)

Expression Databases

TENOR (Os06t0187000-01)

Others

Oryzabase (9121)

Transcript

2756 bp

>Os06t0187000-01 Similar to Origin recognition complex 1.
ATTTCAAATCCACACTCCGCCTCCCCTCTCCGGCCGCCGCCGGCGAGATGGATCTCTCCG
CCACCCCGTCCAGATCCAAATCCGGCCTCAGATCCTCCCCGAGGAAGCCCGTCGCCGCCC
CCGCCGTGGCCCAGATGGACCTCTCCACCCCGTCCAAGCCGACCCCCAGGCGGAAGCCCA
AGGCGCCGCCGGTGGCGGCTCCGATGTCCCCCGTGACCCCGTCCTCCGTCCGCCGCTCCT
CCCGCCTCCTCGAGACGCCGACCAAGGTAACTTCCGAGACCCCCGTGAAGCCCACCCCAA
CCCCGAAGCGGAAGCGCGCCGCGCCGTCGCCGTCGCCGAAGACGCCGACCCAGTCCGAGC
CCAAGCGGCAGCGgcagaggcagaggcagaggcagcagccgaagaagccgaagaagaggG
CGTACTACCGGAAGGTGGTGTACGACGGCGGGGAGTTCGCCGCCGGGGACGACGTGTACG
TGAAGCGGCGGGATGGCGCGGAGTCCGACGCGGAGGACCCGGAGGCGGAGGAGTGCCGCG
TGTGCTTCCGCGCCGGCGCCGCGGTGATGGTGGAGTGCGACGTGTGCCTCGGCGGGTTCC
ACCTGCGGTGCGTGCGCCCGCCGCTGCGGCGCGTGCCGGAGGGGGACTGGGCGTGCCCCT
ACTGCGAGGCCGAGCGCGCGGGGAAGGCCATCGAGAGGCCCAAGCCGCCGGAGGGGAAGC
GCATCGTGAGGACCGCCAAAGAGAAGCTTCTCTCCAGTGATTTGTGGGCTGCACGAATCG
AGAGTTTATGGAGGGAGCCAGATGGAATATTCTGGGCAAAGGTAAGATGGTATATTATCC
CTGAAGAGACTGCAGCAGGAAGGCAGCCACATAATTTGCGTAGGGAGCTGTACCGCACCA
ATGATCTTGCAGACATTGAGATGGAAACAATTCTTAGACATTGTTATGTCATGAGCCCCA
AAGAATTTAAGGATGCTAGTGATCAAGGAGATGACGTATTCTACTGTGAATATGAATATG
ACATACACTGGCATAATTTTAAGCGTCTGGCAGACATCGATGATGAACCTGAGACAAAGG
AAGATCCTGGCGACGAGCCATACAATGCTGGTAATGATTATGTCAGTGACTCGGATGAAG
ATTCTGAATATGATGAGGAGGAAGAACCTACTAAATGTAGTTCTGCTAGAACACATCAAT
CACATGCGTTGGCTGCGAATCTGCGGAAAGGGAGGACATATGGCCTACAAAAAATTGGGA
TCCGTAAAATTCCTGAACATGTCCGGTGTCATCAAAAGACCAATCTGGAGAAGGCAAAAG
CAACCCTGTTATTGGCAACTCTTCCTAAGTCGTTACCTTGTAGGGATAAAGAAATGGAGG
AGATATCTGCATTTGTGAAGGATGCAATTTGCAATGATCAATGTCTAGGACGCTGCCTTT
ATATTCATGGTGTACCAGGCACTGGCAAGACTATGAGTGTACTTGCAGTTATGAGGAGGC
TAAGATCCGAGCTTGATTCTGGGAATCTGAGGCCTTATTCTTTCATAGAGATTAATGGTC
TTAAATTAGCTTCTCCAGAGAATATCTACAAGGTTATATATGAACAGTTGAGTGGGCATA
GGGTAGGGTGGAAAAAAGCCCTTCATTATTTAACCGAGCACTTTTCAGGTGGCACTAAAA
TTGGCAAACAAGCAAACCAGCCAATTATTTTGCTCATCGATGAGCTTGATCTTCTTTTGA
CGAGAAATCAGTCGGTGCTGTATAACATTCTTGACTGGCCCACCAGGCCAAATTCAAACC
TAGTTGTCATAGGTATAGCGAACACAATGGATCTTCCTGAAAAGTTATTGCCTCGTATTT
CAAGTCGGATGGGTATCCAACGACTGTGTTTTGGCCCATATAATTATCGGCAACTGCAGG
AGATCATTACAAGCCGTCTAAAGGGCATTGATGCCTTTGAAGACCAAGCTATTGAATTTG
CTTCTAGAAAGGTAGCTGCTATGTCTGGTGATGCAAGGCGAGCCTTAGAAATATGTAGAC
GTGCAGCAGAGTTTGCAGATTACCGCGTTAAACAATCTGGGCACACTTCTGTGAATAGAG
GAAAAAATGTTGTTTGCATGGGTGACATAGAAGCTGCTATTCAGGAAGTCTTTCAGGCAC
CACATATTCAAGTAATGAAGAACTGCCCAAAATTTGGAAAGATTATATTGGTCGCTATGG
TTCATGAATTATACAGAAGTGGGCTAGGTGAAGTGATGTTCGATAAGCTGGCAGCAACTG
TCCTCTCTTGGTGCCATGTCAACAGAGAATTATTGCCTGGCTATGATACTCTTCTGAAAA
TCTGTTGCAAGCTTGGTGAAGGTAAGATAATTCTCTGCGAGGAAGGCACTAAGCACAAGT
TGCAGAAGCTTCAGCTTAACTATCCAAGTGACGATGTAACTTTTGCCCTGAAGGAATCCC
CAGATATTCCATGGTTGTCCAAGTACCTGTGAAGTTTACACTTGCAGCGGTTGTACTTTC
CCAGCATTTCATTCATCTACTCCTGGAGTTGGAGAGCAACGATCGCAACTACTTGCCCTT
GATCAGCAAATCTCGGAATTTATGTGGGTCCAATTGTTCATCTTCCAAAAGATATCGACT
CGAAGGATGCCGCTGCAACAAAATGTAAATGCAGTGTCGCACCAGGACTGTAACATATGT
ATGATTCGAAGGAGATTGTAGGTCGCCATTTTATTTTCGCCAATCTGTTGTTACCC

CDS

759 bp

>Os06t0187000-01 Similar to Origin recognition complex 1.
TTTCAAATCCACACTCCGCCTCCCCTCTCCGGCCGCCGCCGGCGAGATGGATCTCTCCGC
CACCCCGTCCAGATCCAAATCCGGCCTCAGATCCTCCCCGAGGAAGCCCGTCGCCGCCCC
CGCCGTGGCCCAGATGGACCTCTCCACCCCGTCCAAGCCGACCCCCAGGCGGAAGCCCAA
GGCGCCGCCGGTGGCGGCTCCGATGTCCCCCGTGACCCCGTCCTCCGTCCGCCGCTCCTC
CCGCCTCCTCGAGACGCCGACCAAGGTAACTTCCGAGACCCCCGTGAAGCCCACCCCAAC
CCCGAAGCGGAAGCGCGCCGCGCCGTCGCCGTCGCCGAAGACGCCGACCCAGTCCGAGCC
CAAGCGGCAGCGgcagaggcagaggcagaggcagcagccgaagaagccgaagaagaggGC
GTACTACCGGAAGGTGGTGTACGACGGCGGGGAGTTCGCCGCCGGGGACGACGTGTACGT
GAAGCGGCGGGATGGCGCGGAGTCCGACGCGGAGGACCCGGAGGCGGAGGAGTGCCGCGT
GTGCTTCCGCGCCGGCGCCGCGGTGATGGTGGAGTGCGACGTGTGCCTCGGCGGGTTCCA
CCTGCGGTGCGTGCGCCCGCCGCTGCGGCGCGTGCCGGAGGGGGACTGGGCGTGCCCCTA
CTGCGAGGCCGAGCGCGCGGGGAAGGCCATCGAGAGGCCCAAGCCGCCGGAGGGGAAGCG
CATCGTGAGGACCGCCAAAGAGAAGCTTCTCTCCAGTGA

Protein

253 aa

>Os06t0187000-01 Similar to Origin recognition complex 1.
FQIHTPPPLSGRRRRDGSLRHPVQIQIRPQILPEEARRRPRRGPDGPLHPVQADPQAEAQ
GAAGGGSDVPRDPVLRPPLLPPPRDADQGNFRDPREAHPNPEAEARRAVAVAEDADPVRA
QAAAAEAEAEAAAEEAEEEGVLPEGGVRRRGVRRRGRRVREAAGWRGVRRGGPGGGGVPR
VLPRRRRGDGGVRRVPRRVPPAVRAPAAAARAGGGLGVPLLRGRARGEGHREAQAAGGEA
HREDRQREASLQ*

5'UTR

chr06:4393423..4393423 (+ strand) : 1 bp

CDS

chr06:4393424..4394182 (+ strand) : 759 bp

3'UTR

chr06:4394183..4394206 (+ strand) : 24 bp

chr06:4394679..4394814 (+ strand) : 136 bp

chr06:4394907..4395059 (+ strand) : 153 bp

chr06:4395168..4395311 (+ strand) : 144 bp

chr06:4395407..4395558 (+ strand) : 152 bp

chr06:4395636..4395735 (+ strand) : 100 bp

chr06:4395836..4395958 (+ strand) : 123 bp

chr06:4396059..4396220 (+ strand) : 162 bp

chr06:4396373..4396430 (+ strand) : 58 bp

chr06:4396507..4396685 (+ strand) : 179 bp

chr06:4397477..4397585 (+ strand) : 109 bp

chr06:4397750..4397820 (+ strand) : 71 bp

chr06:4398074..4398169 (+ strand) : 96 bp

chr06:4398910..4398986 (+ strand) : 77 bp

chr06:4400166..4400249 (+ strand) : 84 bp

chr06:4400631..4400790 (+ strand) : 160 bp

chr06:4400927..4401094 (+ strand) : 168 bp

FASTA

>Os06t0187000-01 class=Sequence position=chr06:4393423..4401094 (+ strand)
ATTTCAAATC CACACTCCGC CTCCCCTCTC CGGCCGCCGC CGGCGAGATG GATCTCTCCG CCACCCCGTC CAGATCCAAA
TCCGGCCTCA GATCCTCCCC GAGGAAGCCC GTCGCCGCCC CCGCCGTGGC CCAGATGGAC CTCTCCACCC CGTCCAAGCC
GACCCCCAGG CGGAAGCCCA AGGCGCCGCC GGTGGCGGCT CCGATGTCCC CCGTGACCCC GTCCTCCGTC CGCCGCTCCT
CCCGCCTCCT CGAGACGCCG ACCAAGGTAA CTTCCGAGAC CCCCGTGAAG CCCACCCCAA CCCCGAAGCG GAAGCGCGCC
GCGCCGTCGC CGTCGCCGAA GACGCCGACC CAGTCCGAGC CCAAGCGGCA GCGgcagagg cagaggcaga ggcagcagcc
gaagaagccg aagaagaggG CGTACTACCG GAAGGTGGTG TACGACGGCG GGGAGTTCGC CGCCGGGGAC GACGTGTACG
TGAAGCGGCG GGATGGCGCG GAGTCCGACG CGGAGGACCC GGAGGCGGAG GAGTGCCGCG TGTGCTTCCG CGCCGGCGCC
GCGGTGATGG TGGAGTGCGA CGTGTGCCTC GGCGGGTTCC ACCTGCGGTG CGTGCGCCCG CCGCTGCGGC GCGTGCCGGA
GGGGGACTGG GCGTGCCCCT ACTGCGAGGC CGAGCGCGCG GGGAAGGCCA TCGAGAGGCC CAAGCCGCCG GAGGGGAAGC
GCATCGTGAG GACCGCCAAA GAGAAGCTTC TCTCCAGTGA TTTGTGGGCT GCACGAATCG AGAGGTCAGT GAAAATTGTG
CTCTGTGGTT ATTTTGTAGT CAGTATGGTA GGCAGAAGTT GATTCCGTTC AATTATTGTT TCGATTCATT TCAACTTGCT
TGAACTAGCC ACATTACGAC GAATTCTAGT GAATCTTATA GTCAGAATGA GGTAGCATTG AGCAGTAATG ACGAACTGGT
GGTGTGATTG TGTGAATAGG ATGTGTAACG GCGCATCCTT GTCATGATTT AGTTGTTCCA GTAATGAATT CTGCATAGAC
AATCGTTTGT TCTGGCCTTG AATTAGGTCT GATACCCCAT GTCCCCAGCA AAAGAAGGTT GCATCAGTAA TTGGGGTTGG
TGCAAGATGC ACCTGGATAA TTTCTGGATG TTTATCGTTG CAATTAAACC TCTAGTTCTC TACTGTAACA ATTTCACTCG
ACTGCTTGTA AAGTTTGAGA CATACAATTT CTTACCAATA CCGTTGGTTG CAACAGTTTA TGGAGGGAGC CAGATGGAAT
ATTCTGGGCA AAGGTAAGAT GGTATATTAT CCCTGAAGAG ACTGCAGCAG GAAGGCAGCC ACATAATTTG CGTAGGGAGC
TGTACCGCAC CAATGATCTT GCAGACATTG AGGTGATAAG TTATTTTCGA GTGATAAATT GGTTCCTTTG GATGGTATTT
TTGTTCATTA TTCATTCTGT TCCTTGCTTT TATGGCTTTT GCAGATGGAA ACAATTCTTA GACATTGTTA TGTCATGAGC
CCCAAAGAAT TTAAGGATGC TAGTGATCAA GGAGATGACG TATTCTACTG TGAATATGAA TATGACATAC ACTGGCATAA
TTTTAAGCGT CTGGCAGACA TCGATGATGA ACCTGAGGTA CATGTACTGA AACTTGGTTA TAGACTGTTC ATAGTAGGAG
TGTAGGACTC AGGGGCACCA TTCTGGTAGT CAAGAAGTGA ACCTCATCCT ACTCTGTTAT TGTAGACAAA GGAAGATCCT
GGCGACGAGC CATACAATGC TGGTAATGAT TATGTCAGTG ACTCGGATGA AGATTCTGAA TATGATGAGG AGGAAGAACC
TACTAAATGT AGTTCTGCTA GAACACATCA ATCACATGCG TTGGCTGCGG TACCAACCAT TCCTCGTCCT CCCCCCCTCT
TGCCTGTCTC CTCTCTGCTA GTGTTGCACT TCATGCTTTA CTGAAATGAC ATGCCCATTT GCAGAATCTG CGGAAAGGGA
GGACATATGG CCTACAAAAA ATTGGGATCC GTAAAATTCC TGAACATGTC CGGTGTCATC AAAAGACCAA TCTGGAGAAG
GCAAAAGCAA CCCTGTTATT GGCAACTCTT CCTAAGTCGT TACCTTGTAG GGATAAGTAT GTTAGTACAT TTTTGCAGCT
TGTTTCAACC ACTTTCTTTT GCAAACTGCT TTTGAGTTGA AGTCTCATGT CAGAGAAATG GAGGAGATAT CTGCATTTGT
GAAGGATGCA ATTTGCAATG ATCAATGTCT AGGACGCTGC CTTTATATTC ATGGTGTACC AGGCACTGGC AAGGTAACTA
ACCATCCTTT ACTGTCCCCT ATGATGGTTT GATGTCCTTT TCTGTGGCTG AAGGCTAAGC AATATTTTCT GTGCCTACTT
TTTCAACCTG TAGACTATGA GTGTACTTGC AGTTATGAGG AGGCTAAGAT CCGAGCTTGA TTCTGGGAAT CTGAGGCCTT
ATTCTTTCAT AGAGATTAAT GGTCTTAAAT TAGCTTCTCC AGAGAATATC TACAAGGTAT GTGAACTTCT ATCTTGGTTG
AATACTATGA TTGTCCTAGT AAACCATATC AGCCATGTTA AAAGGATTAT AATGCATATA ATTTTAATAT ATGCAGGTTA
TATATGAACA GTTGAGTGGG CATAGGGTAG GGTGGAAAAA AGCCCTTCAT TATTTAACCG AGCACTTTTC AGGTGGCACT
AAAATTGGCA AACAAGCAAA CCAGCCAATT ATTTTGCTCA TCGATGAGCT TGATCTTCTT TTGACGAGAA ATCAGTCGGT
AATAATTTGT AGCTGAACCT GTTGAGTAGT TCAGCAATTT TGTATTCTAT TGTTTGGAAA ATGATAATTG TTTGATATTT
CGTTTTGTTT GTCACTTTGT TTTACCATGT AGATTCATGT TCATTGACAT TTGAGCTAAT GTTTTGTCAG GTGCTGTATA
ACATTCTTGA CTGGCCCACC AGGCCAAATT CAAACCTAGT TGTCATAGGT ACCTATACTT TTGTTTGTTT TACGTGTGAT
TTTAGATGGC CTTTTAATTA CTCTTTGGCT GTTACTGAAC GCAGGTATAG CGAACACAAT GGATCTTCCT GAAAAGTTAT
TGCCTCGTAT TTCAAGTCGG ATGGGTATCC AACGACTGTG TTTTGGCCCA TATAATTATC GGCAACTGCA GGAGATCATT
ACAAGCCGTC TAAAGGGCAT TGATGCCTTT GAAGACCAAG CTATTGAATT TGCTTCTAGA AAGGTTTGGA ATGCAGTGTC
ATGTGTAAAT CTTTTCTATT ATTCACCCAT GTCTTTTCTG TGACTGTTGC TTTGTCCATC CTATTTGCAA TTTTTTTTCC
TGAAGGGTGA ATTTATGCAA CATGTCTTTT GTTTTAAGGT TATTTCATTA TTTTGTTCTC TGCATATGAA TTTTCCATGC
CATTAAACAC CTTTTTGCTA CCGCTTGTCC GATAACAAAA ACTTTGGATG TTCTGAGTTC CTAGTCAAAC TAATAAATGA
GTGGCAGGTG CTGTAATCAC TCTACACTTT TCCCTTTTCC AACAAATACT GTACAGAACA CATTGTCTGT TTAGTCAATG
ATTGCATGCC ATACGTGTAG CAGTCTTACT TTTGGGGGAT TGAACTTACA AACTAAGGAA CACCTCATGA TCTAGGAGAT
CAATTATTTG TGTCATCTGT AGTTAGTTAC TTAAGACACT TAGCAATTTC TTTTCATTGT AGTTCCTTTT TGTATGTTCC
TGCAAGTTCA GTTGACAGTT GACACCAACG GAAGCCAGTG GACTAACTGC ATTCACAGCA CTGTGGTTTG GTTGCACACT
GACTGTTAAG TGTCATCTGT CATTTCATCC CGGATGAACA TTACTTATTA CTTCACTGAG TTTCATCATT CCATATTACA
GGAAAAAGTT ATATGTTTCT ATAGAAAAGT CAAACAACAA GCAATGGCCC ATACAACGCC CCCTCCTGTT GTCACATGCT
GTAGGGTTCT GTTGGCATGT GTTTTATTCA ACTGACTATT GCCTACTTGT ACAGGTAGCT GCTATGTCTG GTGATGCAAG
GCGAGCCTTA GAAATATGTA GACGTGCAGC AGAGTTTGCA GATTACCGCG TTAAACAATC TGGGCACACT TCTGTGAATA
GAGGTACGGA CCACATATCT ACAAGCCATT TATTGCAGTC ATGGATTCTG GATTTATGTA ATCTTGATGA ATATATATTC
AAGTACTATG GTCTTATGAC TTCATCCCTT CATTCGTATC CAATTCCAGC TGTGTATAGT GATCAAACTT TAATCTGATA
CCTGTAGGAA AAAATGTTGT TTGCATGGGT GACATAGAAG CTGCTATTCA GGAAGTCTTT CAGGCACCAC ATATTCAAGT
AAGTGGGCAC TGATTGCTTG TTTTAAGAAA TCAGACTCCT AGTTCACTTT GTAATGCAGT ACATTATTCA GTTAGGGGTT
GGTTACTGCA CATACTTAGC TTGCCCTTCC CTAACAAGAC CAATTACTTT GGCTAGGTAC ACCTTCAGGT GTAGAGACCA
GGAGTTATCG TCCATTATCT AACAAAACTT AACCAATTAC TAATGTTAGC TGACCTTCTA AGCCTCACCT GTAACTTTTT
TCCTCTAACA GGTAATGAAG AACTGCCCAA AATTTGGAAA GATTATATTG GTCGCTATGG TTCATGAATT ATACAGAAGT
GGGCTAGGTG AAGTGATGTT CGATAAGGTG AGCACCCACT TTTTGTTGTT TTAATTTATA gagcactgct acacatacta
gctttttctt gctaaatttt tactaacaat catcttaacc gtttgattta ggtagatgga agttataaaa aatttagata
ctcatagaat gacacatcag tgttagtaag aaaaaaaata gtacatagag ccttttccTA ATTTATATGT TGCTGGCCTA
GCTTTGTGAG CATAAAGAAA AAGCAAGGTA GAGATTGACT TTTCTCTGAT TCTAATGCAA AAATATCACC TCTGTTTATT
CTCTAGTAGG TGATTCATCA AACTTATTAG GCCTTTTTAG ACAGCTGTAT CCACTGTCTT TCAAGTTTCA ATAGTACAGC
ATATTACCGT CCTTCACATG ACTTCAGAAT TCACTGTAAC AGTATTACTA CAACACATAC TGGTTATTTC CCTGAATCAG
TACAATGGCC TGCAGGGCTG AAACGTGCAA GTGTTTTGTA CTTTGTCATG TATTCTTCAT TAACATTTTC AATGCATCGT
TTTATTTTAA CAGCACCTTG TATTTATGTG AATTGAGGCA GATACAAAGT CTTGTTTTGC TTAAGAAGTT CCCTTGGTGT
CAGTACTTTT AATTCTTTAG TGAATTACTT TTGAGATGTC AATAATCCTA ATTGATGTTA TGCTCATGCT TAATATTGTT
GGTGGTTTGA AGGAAGAAAT CTGATGGGCT TTCCTATTAT GCTGTAGCTG GCAGCAACTG TCCTCTCTTG GTGCCATGTC
AACAGAGAAT TATTGCCTGG CTATGATACT CTTCTGAAAA TCTGGTAAAT GAATCTGGTT TTTTGTTTAC TTCATATTAC
ATGATTTTTT CCCCAAATGT GGACGGTGCT CTTTCATTTG CTTAAGTTTG GATTGCAAGC GCAGGTGCAT TGGCATGCTT
GTGTTCCAAG AGGGATAAAT ATTActccct ccttcccaaa ttgataatca tatatggaat acacaatttc tcaaattgat
catcatataa ctgcatggat acggatttca tcggaatata attaatgtag catgggagaa tgtgtgcatg ctaagggtgt
aattggcatg gtgttttaat cgatatatac attgtgggag aatgtgtgca tgatgtcttg attgatgtga tttaaattat
cattggcctt ggcgtataaa catatatgat gatcaatttg ggatggaagg agTAATGAAC AATGAATCCC AGTTCTAGCC
AGGCAAAATA TTCTTAGAAT CATAGAAATG GATGGGGTAT TACATCTTCg attaaatttc acaaaactac agatactatg
accaaattat cacaaaacta catatttaac tcagtgtatc acaaaactac acatttaaca tcaaatttat cataaaacta
cacatttaag atgaagtgtc acaaaacaca tgtttagtaa ctaaattatc ataaaactac gggtttagaa ccaatttaat
cacaaagtaa taatgtttat agctccacca taacaatggt gctagggatt taaactccaa aagttgtagt tttgtgataa
gttcaatatt aaatatgcat ttttgtgata cttaacctaa aatctgcagt tttgtgataa atttggtact aaatgtgtag
ttttatgata taactcctta aatctgtagt tttgtgataa tttggtcaaa atacctgtag ttttgtgaaa tttactcTAC
ATCTTCTGAT AAAAAAAACA CATGTTAAAA CATGGCCTGC CCTGCTATCA TTTTTTTTCT TCTGTTACTA GTTCCTGCCA
AGATTTCATT CAAGTGACAG TATATCTGCT GGAACTTGAC CTCTCTCATT TTCACCCTCT CTGCTAGTTG TATGGGGGCA
TTAAAACATT CACAGTGGTG CTGTTTTATC TTCATTCTCG AATGTGACTA ATTTCGTTTA TACTTATGTG TATGAAATAA
CTTGGTGTGT GTTCCTATTG CAGTTGCAAG CTTGGTGAAG GTAAGATAAT TCTCTGCGAG GAAGGCACTA AGCACAAGTT
GCAGAAGCTT CAGCTTAACT ATCCAAGGTT AGCTTGCAAG ATTGTGTTTG CCATTGAAAT TGGCATTACA AGGCACCTTT
ATGCCGACTC TTTACTTACT GCCTTTTAAA GACTATCAGA GTCATCTTTT GGGGGAAAAT TCAATTTGAA TCATTTACAT
GTTTAAATTA TACATCGTGT GTATTGTTCC CTCGTCAACT TAACTTTTTG TTTGAACGAA TTAAAGCCTA GAGGTTCTAG
TTTTAAGACT TGGCACTTAG CTACCCCATT ATTAGTGATC CACTTCGGTC ATTGGTGGAG CCTTGACGTG AGCGGAGAAC
TTTTGGTTAA TCTAGCTGGA TGAAAACTTA ATATGCACCT CTTTTATCAT GTAAAACTGT ACTGATGATT ATTTTTCTTG
TCTGGCAGTG ACGATGTAAC TTTTGCCCTG AAGGAATCCC CAGATATTCC ATGGTTGTCC AAGTACCTGT GAAGTTTACA
CTTGCAGCGG TTGTACTTTC CCAGCATTTC ATTCATCTAC TCCTGGAGTT GGAGAGCAAC GATCGCAACT ACTTGCCCTT
GATCAGCAGT AAGTTTGAAC ATGTTCCCTT GTTCATTTTT TCGTACCTTT GCAGAAGTTT GAAGGCCATC TAGTATTTTC
TTGTCATGAA CCATACTCCA CACTGGAGCA TGCAACACTA ACAAGCCTAG CGCATCTTCT GCAGAATCTC GGAATTTATG
TGGGTCCAAT TGTTCATCTT CCAAAAGATA TCGACTCGAA GGATGCCGCT GCAACAAAAT GTAAATGCAG TGTCGCACCA
GGACTGTAAC ATATGTATGA TTCGAAGGAG ATTGTAGGTC GCCATTTTAT TTTCGCCAAT CTGTTGTTAC CC

Locus: Os06g0187000

Loading...

Locus: Os06g0187000

Loading...