Os06t0187000-02

Locus

Os06g0187000

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

ORC1

CGSNL Gene Name

ORIGIN RECOGNITION COMPLEX 1

Oryzabase Gene Symbol Synonym(s)

OsORC1

Oryzabase Gene Name Synonym(s)

Transcript Evidence

AK105033 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-030-E06 (Online Clone Ordering)

Expression Databases

TENOR (Os06t0187000-02)

Others

Oryzabase (9121)

Transcript

264 bp

>Os06t0187000-02 Non-protein coding transcript.
TTCATTCATCTACTCCTGGAGTTGGAGAGCAACGATCGCAACTACTTGCCCTTGATCAGC
AAATCTCGGAATTTATGTGGGTCCAATTGTTCATCTTCCAAAAGATATCGACTCGAAGGA
TGCCGCTGCAACAAAATGTAAATGCAGTGTCGCACCAGGACTGTAACATATGTATGATTC
GAAGGAGATTGTAGGTCGCCATTTTATTTTCGCCAATCTGTTGTTACCCAAGAAACTTTG
CTCTGGCAGTGTTGTTTTCTCTTG

FASTA

>Os06t0187000-02 class=Sequence position=chr06:4400730..4401129 (+ strand)
TTCATTCATC TACTCCTGGA GTTGGAGAGC AACGATCGCA ACTACTTGCC CTTGATCAGC AGTAAGTTTG AACATGTTCC
CTTGTTCATT TTTTCGTACC TTTGCAGAAG TTTGAAGGCC ATCTAGTATT TTCTTGTCAT GAACCATACT CCACACTGGA
GCATGCAACA CTAACAAGCC TAGCGCATCT TCTGCAGAAT CTCGGAATTT ATGTGGGTCC AATTGTTCAT CTTCCAAAAG
ATATCGACTC GAAGGATGCC GCTGCAACAA AATGTAAATG CAGTGTCGCA CCAGGACTGT AACATATGTA TGATTCGAAG
GAGATTGTAG GTCGCCATTT TATTTTCGCC AATCTGTTGT TACCCAAGAA ACTTTGCTCT GGCAGTGTTG TTTTCTCTTG

Locus: Os06g0187000

Loading...

Locus: Os06g0187000

Loading...