Os06t0670500-02

Locus

Os06g0670500

Description

Hypothetical conserved gene.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CYP59B

CGSNL Gene Name

CYCLOPHILIN 59B

Oryzabase Gene Symbol Synonym(s)

OsCYP59b, OsCYP-15, OsCYP59-2

Oryzabase Gene Name Synonym(s)

cyclophilin 59b, cyclophilin 15

Transcript Evidence

AK059079 (DDBJ, Best hit)

Protein Evidence

B8B172 (UniProt)

Literature

Note

Manual Curation

Full-length cDNA

001-022-A09 (Online Clone Ordering)

Expression Databases

TENOR (Os06t0670500-02)

RiceXPro (AK059079)

Others

Oryzabase (10074)

KEGG (Os06t0670500-02 (EC:5.2.1.8))

Transcript

664 bp

>Os06t0670500-02 Hypothetical conserved gene.
ATGATCGCAAATCAGGGCTGCCACCTCGGGGTGACCATGACAGGATTAGCCGGGAGAGAA
CTCACAGTGATGAGAATGGTAGAGAAGGTGGTAAAGAAGGTGATAGGGACCGAGGGATTC
GTAAGCACGAGGACTACCACCGTTACAATAAATCTGGTGAACGGAGCTCTAGTAGATACG
ATGATCGTGGCTACAGCAAGCACGAGAGCAGGGGCAAATATAGGGATGGCAATGATGATT
ACAGACGACAACCGGGAGGTGGCAGTCGATATGGCAGGGATAAGTATGAAGGTGAACGGC
GCTACAGAGAAGATGATGGCCATGGAAGGAGTGACCGTCACAAGAGAGATGAAAGTGATA
ACAGGAAAAGAAGCCCAGATACTGGTAAGCATAGAAGAGAAGACGGTGGTCACCGTGAGA
CAAGCAAGCACAGGGAAAGGAGGCAGAGAGATGATAGATAGGTCACTGCATCACCGTCAG
TTTTGTCTTGCCTGTTTCTCATCATACATTGAATTTTGTCATTCTTAATCCAAAGATAGC
ACCAGAACACTAAACATGTAGCTTAGAATCTGCGTGTAGACATTATGAGAGCTCCACTGG
CTACAGATTGTTGTAACTTGTAGACCTTTTCTTTTCTATACATGCTCATGGACGTTGTTC
TTTT

CDS

459 bp

>Os06t0670500-02 Hypothetical conserved gene.
GATCGCAAATCAGGGCTGCCACCTCGGGGTGACCATGACAGGATTAGCCGGGAGAGAACT
CACAGTGATGAGAATGGTAGAGAAGGTGGTAAAGAAGGTGATAGGGACCGAGGGATTCGT
AAGCACGAGGACTACCACCGTTACAATAAATCTGGTGAACGGAGCTCTAGTAGATACGAT
GATCGTGGCTACAGCAAGCACGAGAGCAGGGGCAAATATAGGGATGGCAATGATGATTAC
AGACGACAACCGGGAGGTGGCAGTCGATATGGCAGGGATAAGTATGAAGGTGAACGGCGC
TACAGAGAAGATGATGGCCATGGAAGGAGTGACCGTCACAAGAGAGATGAAAGTGATAAC
AGGAAAAGAAGCCCAGATACTGGTAAGCATAGAAGAGAAGACGGTGGTCACCGTGAGACA
AGCAAGCACAGGGAAAGGAGGCAGAGAGATGATAGATAG

Protein

153 aa

>Os06t0670500-02 Hypothetical conserved gene.
DRKSGLPPRGDHDRISRERTHSDENGREGGKEGDRDRGIRKHEDYHRYNKSGERSSSRYD
DRGYSKHESRGKYRDGNDDYRRQPGGGSRYGRDKYEGERRYREDDGHGRSDRHKRDESDN
RKRSPDTGKHRREDGGHRETSKHRERRQRDDR*

5'UTR

chr06:27797838..27797839 (+ strand) : 2 bp

CDS

chr06:27797840..27798298 (+ strand) : 459 bp

3'UTR

chr06:27798299..27798501 (+ strand) : 203 bp

FASTA

>Os06t0670500-02 class=Sequence position=chr06:27797838..27798501 (+ strand)
ATGATCGCAA ATCAGGGCTG CCACCTCGGG GTGACCATGA CAGGATTAGC CGGGAGAGAA CTCACAGTGA TGAGAATGGT
AGAGAAGGTG GTAAAGAAGG TGATAGGGAC CGAGGGATTC GTAAGCACGA GGACTACCAC CGTTACAATA AATCTGGTGA
ACGGAGCTCT AGTAGATACG ATGATCGTGG CTACAGCAAG CACGAGAGCA GGGGCAAATA TAGGGATGGC AATGATGATT
ACAGACGACA ACCGGGAGGT GGCAGTCGAT ATGGCAGGGA TAAGTATGAA GGTGAACGGC GCTACAGAGA AGATGATGGC
CATGGAAGGA GTGACCGTCA CAAGAGAGAT GAAAGTGATA ACAGGAAAAG AAGCCCAGAT ACTGGTAAGC ATAGAAGAGA
AGACGGTGGT CACCGTGAGA CAAGCAAGCA CAGGGAAAGG AGGCAGAGAG ATGATAGATA GGTCACTGCA TCACCGTCAG
TTTTGTCTTG CCTGTTTCTC ATCATACATT GAATTTTGTC ATTCTTAATC CAAAGATAGC ACCAGAACAC TAAACATGTA
GCTTAGAATC TGCGTGTAGA CATTATGAGA GCTCCACTGG CTACAGATTG TTGTAACTTG TAGACCTTTT CTTTTCTATA
CATGCTCATG GACGTTGTTC TTTT

Locus: Os06g0670500

Loading...

Locus: Os06g0670500

Loading...