Os08t0116500-02

Locus

Os08g0116500

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

Oryzabase Gene Name Synonym(s)

Ribosomal protein L12eII, Acidic ribosomal protein P2, Ribosomal protein rp21c

Transcript Evidence

AK060433 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

  • CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

001-011-B07 (Online Clone Ordering)

Expression Databases

TENOR (Os08t0116500-02)

Others

Oryzabase (17660)

Transcript

278 bp

>Os08t0116500-02 Non-protein coding transcript.
GTGCTGCTGCTGCCCCAGCTGCCGAGGAGAAGAAGGAGGAGGCGAAGGAGGAGAGCGACG
ATGACATGGGTTTCAGCTTGTTCGACTAAGCAGTCCACAGATGTTAGCCAGTCCGCCTAT
GCTTTGCAAGACTATCTTATGTTGTGTCTTTTAGGTTCACTTAAAGTACTCTCAAGTTTT
GAGTTTTGATATGGTGTTATCGAGAATCTGTGTCTGTGGGATGAGAACCTCAAACCTCCT
TGGATGGTCCTATTAGAATGAAACCGTTCTACATTCTT

FASTA

>Os08t0116500-02 class=Sequence position=chr08:905207..905583 (+ strand)
GTGCTGCTGC TGCCCCAGCT GCCGAGGAGA AGAAGGTGAG CTATACATAC AATTTGCTTG TTATTTTTGT CATGACACAT
GTATGTTTTG TTTTGTTTTG TAACTTACAA ATGTCTTGGT TTTCCTCTTA TCAGGAGGAG GCGAAGGAGG AGAGCGACGA
TGACATGGGT TTCAGCTTGT TCGACTAAGC AGTCCACAGA TGTTAGCCAG TCCGCCTATG CTTTGCAAGA CTATCTTATG
TTGTGTCTTT TAGGTTCACT TAAAGTACTC TCAAGTTTTG AGTTTTGATA TGGTGTTATC GAGAATCTGT GTCTGTGGGA
TGAGAACCTC AAACCTCCTT GGATGGTCCT ATTAGAATGA AACCGTTCTA CATTCTT