Os08t0131200-01

Locus

Os08g0131200

Description

Similar to Non-specific lipid-transfer protein.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsLTP1.7, OsLtpI.7

Oryzabase Gene Name Synonym(s)

non-specific lipid transfer protein 1.7, lipid transfer protein 1.7, type 1 non-specific lipid transfer protein 7

Transcript Evidence

AK063493 (DDBJ, Best hit)

Protein Evidence

A2YQX8 (UniProt)

Literature

Note

  • CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

001-116-C12 (Online Clone Ordering)

Expression Databases

TENOR (Os08t0131200-01)

Others

Oryzabase (13516)

Transcript

547 bp

>Os08t0131200-01 Similar to Non-specific lipid-transfer protein.
GAAGACGACGGCGAAGATGAAGGGAGCGGCTGCGGTGGCGATGGTGGTGGTGGCCGGCTG
CTTGCTGGCGGCGGCGGCGGTGTCCGTCGTCGACGGCGCGGTGACGTGCGGCGACGTGGA
CGCGAGCCTGCTGCCGTGCGTGGCGTACCTGACCGGCAAGGCGGCGGCGCCCTCGGGGGA
TTGCTGCGCCGGCGTGAGGCACCTCCGGACGCTGCCCGTCGGCACCGCCGAGCGGCGGTT
CGCCTGCGACTGCGTGAAGAAGGCGGCGGCGCGGTTCAAGGGGCTCAACGGCGACGCCAT
CCGCGACCTCCCGGCCAAGTGCGCCGCGCCGCTGCCGTTCCCGCTCAGCCTCGACTTCGA
CTGCAACACCATTCCATGAGCATTCTGAACTTCTGGAGATGGAGAGTTGAGACAAAGCTA
GAATAATGAAGATGGTTCATTTCAAGTGAACCTGTTGCTAGTTTGTACAACAAGCTGCAT
GCATGCATGCATGCCTGCCCCTTCTTGTTGGAGACAGTCATGCTTAATGTTTTTTTTATC
TACAATG

CDS

426 bp

>Os08t0131200-01 Similar to Non-specific lipid-transfer protein.
GAAGACGACGGCGAAGATGAAGGGAGCGGCTGCGGTGGCGATGGTGGTGGTGGCCGGCTG
CTTGCTGGCGGCGGCGGCGGTGTCCGTCGTCGACGGCGCGGTGACGTGCGGCGACGTGGA
CGCGAGCCTGCTGCCGTGCGTGGCGTACCTGACCGGCAAGGCGGCGGCGCCCTCGGGGGA
TTGCTGCGCCGGCGTGAGGCACCTCCGGACGCTGCCCGTCGGCACCGCCGAGCGGCGGTT
CGCCTGCGACTGCGTGAAGAAGGCGGCGGCGCGGTTCAAGGGGCTCAACGGCGACGCCAT
CCGCGACCTCCCGGCCAAGTGCGCCGCGCCGCTGCCGTTCCCGCTCAGCCTCGACTTCGA
CTGCAACACCATTCCATGAGCATTCTGAACTTCTGGAGATGGAGAGTTGAGACAAAGCTA
GAATAA

Protein

142 aa

>Os08t0131200-01 Similar to Non-specific lipid-transfer protein.
EDDGEDEGSGCGGDGGGGRLLAGGGGGVRRRRRGDVRRRGREPAAVRGVPDRQGGGALGG
LLRRREAPPDAARRHRRAAVRLRLREEGGGAVQGAQRRRHPRPPGQVRRAAAVPAQPRLR
LQHHSMSILNFWRWRVETKLE*

CDS

chr08:1755976..1756344 (+ strand) : 369 bp

chr08:1756892..1756948 (+ strand) : 57 bp

3'UTR

chr08:1756949..1757069 (+ strand) : 121 bp

FASTA

>Os08t0131200-01 class=Sequence position=chr08:1755976..1757069 (+ strand)
GAAGACGACG GCGAAGATGA AGGGAGCGGC TGCGGTGGCG ATGGTGGTGG TGGCCGGCTG CTTGCTGGCG GCGGCGGCGG
TGTCCGTCGT CGACGGCGCG GTGACGTGCG GCGACGTGGA CGCGAGCCTG CTGCCGTGCG TGGCGTACCT GACCGGCAAG
GCGGCGGCGC CCTCGGGGGA TTGCTGCGCC GGCGTGAGGC ACCTCCGGAC GCTGCCCGTC GGCACCGCCG AGCGGCGGTT
CGCCTGCGAC TGCGTGAAGA AGGCGGCGGC GCGGTTCAAG GGGCTCAACG GCGACGCCAT CCGCGACCTC CCGGCCAAGT
GCGCCGCGCC GCTGCCGTTC CCGCTCAGCC TCGACTTCGA CTGCAACACG TAAGCAtttt caaacaacaa aagaaataga
aataggactt aaaaaaggca cgaatattaa ggaatgatct actattaaat aattagaatg ggtaaggctt cgaagccaaa
tcatctagcg ttggagctag ccggaagatt tctgagcgtt tcccaacaaa agaaatAGCA GTAGATTTTC AAACAACAAT
TTTTTTTAAA AAAATTAAAA GGTATTTCAA AAGAAAAAGG ATTGGACCCA GCCCAACGCC AAGATCTGGG CCAACATATT
TTGGCCCATA TTTGGTAATA TTTTGTCAAA GCCCATACAA ATTTAGATCC AGGTACATCC GCACAGGGTC ATGGCCCAGG
TAGTCCTGTT TTCAAACACA AATATAATGA GATTGTCAAC AAATCTATAC TGTACTGACT AATTCTTAAC AAAATTGAAA
AAATATTTAT TAACAAAAAG AGTATTTTTT TGGGTATTTA ATTATTCTGT ACATGCACTA TTAAACACTG CAACTGGTGG
CTTATATATA TGTTTGTTCA TTTTTAAATG TTGCAGCATT CCATGAGCAT TCTGAACTTC TGGAGATGGA GAGTTGAGAC
AAAGCTAGAA TAATGAAGAT GGTTCATTTC AAGTGAACCT GTTGCTAGTT TGTACAACAA GCTGCATGCA TGCATGCATG
CCTGCCCCTT CTTGTTGGAG ACAGTCATGC TTAATGTTTT TTTTATCTAC AATG

Locus: Os08g0131200

Loading...

Locus: Os08g0131200

Loading...