Os08t0139400-01

Locus

Os08g0139400

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsPUB30

Oryzabase Gene Name Synonym(s)

plant U-box-containing protein 30, U-box protein 30

Transcript Evidence

AK101460 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

J033040E12 (Online Clone Ordering)

Expression Databases

TENOR (Os08t0139400-01)

Others

Oryzabase (17822)

Transcript

432 bp

>Os08t0139400-01 Non-protein coding transcript.
TTGCCAAGAACGCGGTGGAATTAGCTCGGACGCTCGAGAAGCTTTGATGAATTTCATCCA
AACTCCAAACATCAAATTTGTGCGAATTTTGATTCGGCGCCTCTTCGAATCGGTGTTGGG
CTCGGTGTACAAAGGTAGAAACAGCAAAGGTGAACCTTTTTTTGGGGTCTACTCTTCTCT
TCTTTTTGGTTGGGTTCATTTCCCTTCTCTTTTCATGTGGTAGCAGCGTCGAAAGGAAGA
AGAAGAAGAAGAAAAAAAAATAAGTAGAATTTAGTTCCTTTTTTTTTTGTTCATATGCTT
AGAAAAACATGGTCCTCTCATCATTTCACCCAGACCTTCTGTGGTGTTCTGTTCTGGATT
GAATTCTGAATCCCAAAATCATCCAATCTGAAATGTCGTATGATATATGATACATCTCAT
GATCAAGTGATC

FASTA

>Os08t0139400-01 class=Sequence position=chr08:2195441..2195872 (- strand)
TTGCCAAGAA CGCGGTGGAA TTAGCTCGGA CGCTCGAGAA GCTTTGATGA ATTTCATCCA AACTCCAAAC ATCAAATTTG
TGCGAATTTT GATTCGGCGC CTCTTCGAAT CGGTGTTGGG CTCGGTGTAC AAAGGTAGAA ACAGCAAAGG TGAACCTTTT
TTTGGGGTCT ACTCTTCTCT TCTTTTTGGT TGGGTTCATT TCCCTTCTCT TTTCATGTGG TAGCAGCGTC GAAAGGAAGA
AGAAGAAGAA GAAAAAAAAA TAAGTAGAAT TTAGTTCCTT TTTTTTTTGT TCATATGCTT AGAAAAACAT GGTCCTCTCA
TCATTTCACC CAGACCTTCT GTGGTGTTCT GTTCTGGATT GAATTCTGAA TCCCAAAATC ATCCAATCTG AAATGTCGTA
TGATATATGA TACATCTCAT GATCAAGTGA TC

Locus: Os08g0139400

Loading...

Locus: Os08g0139400

Loading...