Os08t0205300-03

Locus

Os08g0205300

Description

Hypothetical conserved gene.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsSET28, SDG740

Oryzabase Gene Name Synonym(s)

SET protein 28

Transcript Evidence

AK063775 (DDBJ, Best hit)

Protein Evidence

Q6ZCF6 (UniProt)

Literature

Note

Manual Curation

Full-length cDNA

001-121-D01 (Online Clone Ordering)

Expression Databases

TENOR (Os08t0205300-03)

RiceXPro (AK063775)

Others

Oryzabase (13392)

KEGG (Os08t0205300-03)

Transcript

453 bp

>Os08t0205300-03 Hypothetical conserved gene.
GTCTGTGGGAACCTGAAGAACGAAGATGAAATTGATGCTCCTGATGGTGGTGATTCCAGC
ATGGCGGATTAGGATGAGCTAAGCATAACCGATCTGCTTGCTGCTTCTTTTGGTGGGAGC
TCATAACACTTTGGTGGTAGGACTTGGGAGTACTTCTGTAAACTGGTTGGAGTTTTGACA
AAAACGGGAGTTTAATACACCTAAATATGGAGAGATGTATGAACAGAACAACATTCATTG
ACTGAATGTGGAACTAGCAATCCTTCTTGTACTCAGCAACGTATATATGAATGTGTATCC
GTTGTAGGGAGTCCTGCTTGTTCTGTACAATTTCTAATGCTCCCCCTTTATCTAGAATGG
TGATTTAGACTTGAGAAATTTATGCAGTCAGAAGCTGATCTCCTGTGATACTTGAAACAT
TCCGTTTTGTCATGTCATGGTGTAGTTGATTGT

CDS

72 bp

>Os08t0205300-03 Hypothetical conserved gene.
GTCTGTGGGAACCTGAAGAACGAAGATGAAATTGATGCTCCTGATGGTGGTGATTCCAGC
ATGGCGGATTAG

Protein

24 aa

>Os08t0205300-03 Hypothetical conserved gene.
VCGNLKNEDEIDAPDGGDSSMAD*

CDS

chr08:6156322..6156393 (+ strand) : 72 bp

3'UTR

chr08:6156394..6156437 (+ strand) : 44 bp

chr08:6157396..6157732 (+ strand) : 337 bp

FASTA

>Os08t0205300-03 class=Sequence position=chr08:6156322..6157732 (+ strand)
GTCTGTGGGA ACCTGAAGAA CGAAGATGAA ATTGATGCTC CTGATGGTGG TGATTCCAGC ATGGCGGATT AGGATGAGCT
AAGCATAACC GATCTGCTTG CTGCTTCTTT TGGTGGGTAA GAATTCCATA CTTGCTGTCA TTATTGTTAT CGGTTTGGTC
TTTTGATTTG ATATCCTACA CAGTCCAAGA CCGTAATATT CAATCCATGA GCACTTGCTG ATCTGTATAG AGTATAAGGA
AATATTTGAC TGAGCTGAAA TGCTAACCTA GTTGCAACAA TCGTAATCCA TTTTATTTTG TTAATTAAGA TATTGTTTAT
GTGGGGGATC TTTTATGGTT TTACCTTTTG AAGTGCTTCC TTACTGGATA ATCAATCAAG CTTCTTCACT TGTATTCGGA
ATACTGTTAA CTTGTTAAAG TGGATGTTAA GATCCTCGGT GCTTGCTTTG TATTAAATAA TAATTCTGTT GTTTGGCAAA
TAAGCGTGTG AAAACCACCA GAATCATCTC TATTGACAAC AGCCACCACC CTCCACCACC ACTGCTGCAT TGTTCAATAT
GCTATTGTTA TTTGTGGATT AGTGTTCTGG TTTGCTGTAA TCGAATCGAG TCCCCTAAGA GACTTAATAC CATTTCAGTA
GAAACTTGGT CATGAGATAG CTGACTAGGG TTGAGAAGTG ATGGCCTGAT GGGATGGTAG TCACTGGAAT TTTTCTGTTA
GAAAAGGAAA AAAGCTTTAG CCACATAATT CCACCCCCAA TTTTGAAAGC GCTAGATAAC CAGGGCGCAT ATAATTATGC
TTGGTCCCTC GCCTCTTTCA TACCTTTATT TTGCTCAAAT GGACCTAAAT GTTTGGGCTA GGTGTATAAC CTGGCTTATT
CCTTCAGAGA AAAAAAAATG AAACTGGAGA GGCTAATGCC AAGTCAAATT GAAGCTGCCA GTGAAATAGC AAATCCGAAG
GTTTATGTTA TGTGATAAAT CAACTATGTT GGGCATATGT CTTTGATTCT ACAAGGGTTC AGACCATTTT TCTTTCTGTA
TTATTATCTG ACAATGTGAA TTGTTATCTC ACAGGAGCTC ATAACACTTT GGTGGTAGGA CTTGGGAGTA CTTCTGTAAA
CTGGTTGGAG TTTTGACAAA AACGGGAGTT TAATACACCT AAATATGGAG AGATGTATGA ACAGAACAAC ATTCATTGAC
TGAATGTGGA ACTAGCAATC CTTCTTGTAC TCAGCAACGT ATATATGAAT GTGTATCCGT TGTAGGGAGT CCTGCTTGTT
CTGTACAATT TCTAATGCTC CCCCTTTATC TAGAATGGTG ATTTAGACTT GAGAAATTTA TGCAGTCAGA AGCTGATCTC
CTGTGATACT TGAAACATTC CGTTTTGTCA TGTCATGGTG TAGTTGATTG T

Locus: Os08g0205300

Loading...

Locus: Os08g0205300

Loading...