Os08t0524600-00

Locus

Os08g0524600

Description

Similar to 60S ribosomal protein L32.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

rpL32_8.1

Oryzabase Gene Name Synonym(s)

Ribosomal protein L32

Transcript Evidence

P51421 (UniProt)

Protein Evidence

P51421 (UniProt)

Literature

Note

  • Exon-intron structures, exon and CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Gene Ontology (GO)

Biological Process: translation (GO:0006412)

Cellular Component: intracellular (GO:0005622)

Cellular Component: ribosome (GO:0005840)

Molecular Function: structural constituent of ribosome (GO:0003735)

Functional domain (InterPro)

Ribosomal protein L32e (IPR001515)

Expression Databases

TENOR (Os08t0524600-00)

Others

Oryzabase (12431)

Transcript

129 bp

>Os08t0524600-00 Similar to 60S ribosomal protein L32.
ACCTACTGTGCCGAGATTGCCCACAACGTCTCTACGAAGAAGCGCAAGGAGATCGTTGAG
CGTGCTGCGCAGCTCGACATCGTGGTCACCAACAAGCTTGCAAGGCTCCGTAGCCAGGAG
GACGAGTAG

CDS

129 bp

>Os08t0524600-00 Similar to 60S ribosomal protein L32.
ACCTACTGTGCCGAGATTGCCCACAACGTCTCTACGAAGAAGCGCAAGGAGATCGTTGAG
CGTGCTGCGCAGCTCGACATCGTGGTCACCAACAAGCTTGCAAGGCTCCGTAGCCAGGAG
GACGAGTAG

Protein

43 aa

>Os08t0524600-00 Similar to 60S ribosomal protein L32.
TYCAEIAHNVSTKKRKEIVERAAQLDIVVTNKLARLRSQEDE*

CDS

chr08:26092558..26092686 (+ strand) : 129 bp

FASTA

>Os08t0524600-00 class=Sequence position=chr08:26092558..26092686 (+ strand)
ACCTACTGTG CCGAGATTGC CCACAACGTC TCTACGAAGA AGCGCAAGGA GATCGTTGAG CGTGCTGCGC AGCTCGACAT
CGTGGTCACC AACAAGCTTG CAAGGCTCCG TAGCCAGGAG GACGAGTAG

Locus: Os08g0524600

Loading...

Locus: Os08g0524600

Loading...