Os09t0511600-02

Locus

Os09g0511600

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

BGLU31

CGSNL Gene Name

BETA-GLUCOSIDASE 31

Oryzabase Gene Symbol Synonym(s)

Os9bglu31, Os9BGlu31

Oryzabase Gene Name Synonym(s)

beta-glucosidase 31

Transcript Evidence

AK105396 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-123-C01 (Online Clone Ordering)

Expression Databases

TENOR (Os09t0511600-02)

Others

Oryzabase (12104)

Transcript

244 bp

>Os09t0511600-02 Non-protein coding transcript.
TTTGAATAGGGTCTTAGAATGAATGGTCTCTCTTCTTCCCCTGGTTTTTGGTTCTTCTGT
TTACAGACCAATGATGGGTCAATGTCAGTCAAATTGTGTGATTTAGATCAATGGGTCAAA
GTGTATGATGTGATTGTGTAATTGTGTCGATTATATATAAAATTTTGAAGTCTCTCGTAG
TTTGAATTTGAAATTGTACACACTACGTATAGGATAGTGGTTATAAATTTTGAATTTTGA
TGCG

FASTA

>Os09t0511600-02 class=Sequence position=chr09:19882650..19882893 (- strand)
TTTGAATAGG GTCTTAGAAT GAATGGTCTC TCTTCTTCCC CTGGTTTTTG GTTCTTCTGT TTACAGACCA ATGATGGGTC
AATGTCAGTC AAATTGTGTG ATTTAGATCA ATGGGTCAAA GTGTATGATG TGATTGTGTA ATTGTGTCGA TTATATATAA
AATTTTGAAG TCTCTCGTAG TTTGAATTTG AAATTGTACA CACTACGTAT AGGATAGTGG TTATAAATTT TGAATTTTGA
TGCG

Locus: Os09g0511600

Loading...

Locus: Os09g0511600

Loading...