Os11t0116000-02

Locus

Os11g0116000

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

CGSNL Gene Name

Oryzabase Gene Symbol Synonym(s)

OsLTP1.12, OsLtpI.12

Oryzabase Gene Name Synonym(s)

non-specific lipid transfer protein 1.12, lipid transfer protein 1.12, type 1 non-specific lipid transfer protein 12

Transcript Evidence

AK060726 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-031-H01 (Online Clone Ordering)

Expression Databases

TENOR (Os11t0116000-02)

Others

Oryzabase (13521)

Transcript

115 bp

>Os11t0116000-02 Non-protein coding transcript.
ATGTTGCACGCTCCGTGCGTGCATGCTATCTTAATTTTCTTGACTCTGTACACCGCTCTG
TGTACGTGTAATCCTACGTTGATGAATTGCATCTTGTCCAGACTTGGACCTAGCT

FASTA

>Os11t0116000-02 class=Sequence position=chr11:716148..716262 (+ strand)
ATGTTGCACG CTCCGTGCGT GCATGCTATC TTAATTTTCT TGACTCTGTA CACCGCTCTG TGTACGTGTA ATCCTACGTT
GATGAATTGC ATCTTGTCCA GACTTGGACC TAGCT

Locus: Os11g0116000

Loading...

Locus: Os11g0116000

Loading...