Os12t0291100-02

Locus

Os12g0291100

Description

Similar to Ribulose bisphosphate carboxylase small chain.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

RBCS3

CGSNL Gene Name

RUBISCO SMALL SUBUNIT 3

Oryzabase Gene Symbol Synonym(s)

RbcS3, OsRBCS3, OsRbcS3, rbcS

Oryzabase Gene Name Synonym(s)

RuBisCO small subunit 3, Ribulose-1, 5-Bisphosphate Carboxylase/Oxygenase Small Subunit 3

Transcript Evidence

AK058875 (DDBJ, Best hit)

Protein Evidence

Q36688 (UniProt)

Literature

Note

Manual Curation

Full-length cDNA

001-006-F10 (Online Clone Ordering)

Expression Databases

TENOR (Os12t0291100-02)

RiceXPro (AK058875)

Others

Oryzabase (12043)

KEGG (Os12t0291100-02)

Transcript

418 bp

>Os12t0291100-02 Similar to Ribulose bisphosphate carboxylase small chain.
ACGTCAGGCAGGTGCAGTTGATTAGCTTCATCGCCTACAAGCCCCCAGGTTGCGAGGAGT
CTGGTGGCAACTAAGCTAAGATCAAGCATCGCGCTGGTGGATTGCTGCCTATAATAATAG
TATGCAGCTTTGTTTTGGGCTATGTTGATGATATATCAATATATAATATGCTATATATTT
TTATTTTACAGTTTGGTTATGTACCATCTCAATGGCCTCTGCTCTTAACACATATGTAAT
AATCTCTTCCCTCCCTCTCCGGCCGGTTTTATTGTAAGAGTACTACAATTATCGTTGGGT
GAGGATATGTGAAAACAAAGCTCCGGCTATATACACACAAGATATGTATCTAGAGCATAT
CTGATAAATTCGTCGACAATAAAAAAAATGGATGGTATCACGTAATTATGTTTGTTTT

CDS

72 bp

>Os12t0291100-02 Similar to Ribulose bisphosphate carboxylase small chain.
GTCAGGCAGGTGCAGTTGATTAGCTTCATCGCCTACAAGCCCCCAGGTTGCGAGGAGTCT
GGTGGCAACTAA

Protein

24 aa

>Os12t0291100-02 Similar to Ribulose bisphosphate carboxylase small chain.
VRQVQLISFIAYKPPGCEESGGN*

5'UTR

chr12:11263219..11263220 (+ strand) : 2 bp

CDS

chr12:11263221..11263292 (+ strand) : 72 bp

3'UTR

chr12:11263293..11263636 (+ strand) : 344 bp

FASTA

>Os12t0291100-02 class=Sequence position=chr12:11263219..11263636 (+ strand)
ACGTCAGGCA GGTGCAGTTG ATTAGCTTCA TCGCCTACAA GCCCCCAGGT TGCGAGGAGT CTGGTGGCAA CTAAGCTAAG
ATCAAGCATC GCGCTGGTGG ATTGCTGCCT ATAATAATAG TATGCAGCTT TGTTTTGGGC TATGTTGATG ATATATCAAT
ATATAATATG CTATATATTT TTATTTTACA GTTTGGTTAT GTACCATCTC AATGGCCTCT GCTCTTAACA CATATGTAAT
AATCTCTTCC CTCCCTCTCC GGCCGGTTTT ATTGTAAGAG TACTACAATT ATCGTTGGGT GAGGATATGT GAAAACAAAG
CTCCGGCTAT ATACACACAA GATATGTATC TAGAGCATAT CTGATAAATT CGTCGACAAT AAAAAAAATG GATGGTATCA
CGTAATTATG TTTGTTTT

Locus: Os12g0291100

Loading...

Locus: Os12g0291100

Loading...