Os12t0291100-03

Locus

Os12g0291100

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

RBCS3

CGSNL Gene Name

RUBISCO SMALL SUBUNIT 3

Oryzabase Gene Symbol Synonym(s)

RbcS3, OsRBCS3, OsRbcS3, rbcS

Oryzabase Gene Name Synonym(s)

RuBisCO small subunit 3, Ribulose-1, 5-Bisphosphate Carboxylase/Oxygenase Small Subunit 3

Transcript Evidence

AK060619 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

Manual Curation

Full-length cDNA

001-026-C06 (Online Clone Ordering)

Expression Databases

TENOR (Os12t0291100-03)

Others

Oryzabase (12043)

Transcript

281 bp

>Os12t0291100-03 Non-protein coding transcript.
AGCATCGCGCTGGTGGATTGCTGCCTATAATAATAGTATGCAGCTTTGTTTTGGGCTATG
TTGATGATATATCAATATATAATATGCTATATATTTTTATTTTACAGTTTGGTTATGTAC
CATCTCAATGGCCTCTGCTCTTAACACATATGTAATAATCTCTTCCCTCCCTCTCCGGCC
GGTTTTATTGTAAGAGTACTACAATTATCGTTGGGTGAGGATATGTGAAAACAAAGCTCC
GGCTATATACACACAAGATATGTATCTAGAGCATATCTGAT

FASTA

>Os12t0291100-03 class=Sequence position=chr12:11263303..11263583 (+ strand)
AGCATCGCGC TGGTGGATTG CTGCCTATAA TAATAGTATG CAGCTTTGTT TTGGGCTATG TTGATGATAT ATCAATATAT
AATATGCTAT ATATTTTTAT TTTACAGTTT GGTTATGTAC CATCTCAATG GCCTCTGCTC TTAACACATA TGTAATAATC
TCTTCCCTCC CTCTCCGGCC GGTTTTATTG TAAGAGTACT ACAATTATCG TTGGGTGAGG ATATGTGAAA ACAAAGCTCC
GGCTATATAC ACACAAGATA TGTATCTAGA GCATATCTGA T

Locus: Os12g0291100

Loading...

Locus: Os12g0291100

Loading...