Os12t0545900-04

Locus

Os12g0545900

Description

Long noncoding RNA (lncRNA), Regulation of photoperiod-sensitive male sterility

RAP-DB Gene Symbol Synonym(s)

LDMAR, PMS3

RAP-DB Gene Name Synonym(s)

long-day-specific male-fertility-associated RNA

CGSNL Gene Symbol

PMS3

CGSNL Gene Name

PHOTOPERIOD SENSITIVE GENIC MALE STERILITY 3

Oryzabase Gene Symbol Synonym(s)

pms3, LDMAR

Oryzabase Gene Name Synonym(s)

photoperiod-sensitive genic male sterility3, long-day-specific male-fertility-associated RNA

Transcript Evidence

JQ317784 (Nongken 58)

Protein Evidence

NONE

Literature

PMID: 22308482

Note

Manual Curation

November 25, 2020

Others

Oryzabase (2286)

Transcript

1236 bp

>Os12t0545900-04 Long noncoding RNA (lncRNA), Regulation of photoperiod-sensitive male sterility
GATGGCACGAACATTGAGTTTCTAATTGTTCTATTTGTATCAGAAGCTACAACATGTAAA
GTTGAGTTACATTGTTTGTCTTCAAAGTAAAAGAGACAGAAAACTGCCCCAAATCCCCCC
CAAGTCCTTTGTTTCTTCCTTTGCTCTGAATTTTGTCGGAACAGCTACAGAGTGCGCCCA
AAGTGTTCGTCCATGGTTCTTCCCAACAAAACTAATTCTAATGAATAAATAATCTTTTAT
TTTGCAAAATATAATTTAAGAACTGCTGCTCCAAATTTCATAATAGGGAAAAGAGTAAAA
AAATTCATGACATTTAGAGGCCCAGCACTAGCCTAGGAATTTGCTTCCCATATATCTTGT
CCAGTGCTCATGCCATGTTGAAATACTTTTCATTTTTCTTTCATCAAATTGCATGCTTCA
CCAGCACGTCCATATTGAATGCCATCTAAACACTAAAAATACATCCCACAAATCCTTTAG
CATTTTTAACCCGAAAACTTGCTACCACAAGCTTTCCCAGGATGCACATACTGAATCTCT
CTATGTTGACGTTTTTTTTTTGGCAAACAAAAACTCAACTAACAATTTGAGTATAATTTG
TGGACAACATAAATGCTACTCAATGGACATATGAAAGAAAAGCAGAGACATAGATGAGCA
ACATGAGAACTTCAGCTTGAGATATACATACCAACTAGAGATTCAGTTGCTACTGCTTTA
CAAGACTATTTCATAGCACCTACATATAGGAGTGGGAGGCATGGTGAAGCAAAGAAGTGC
ATTGTTTGTCTACCATCCATCAAGAGTAAAATTTTTATCAACACGCAGTTCAGATACTCT
AGATGCAGTATAACTTCTCGGGTCTATCTATAACGGAGCCGCCGCTTCAATTTTCCTATT
GCCTAACCAATGGAGCAAACAATGTATAGTGTCTAGATGGCTTTGGAAAGCAATCCAAGA
ACATCAGTGGTAGCTTGCTCCTAGTCCAGAAGGAAAATGTGTCGCTTGACGAGGTACCAC
TGAATCTTCACCAGCTATCGTGAATGGGATGATCTGAGTTGGATGTGCAACCAAGACTTC
GCCACAAAAATGGGAAATAGTCATACCAAGATGAAGCAAGCTAAGATGCATATATTACCA
ATTATATATGTATCCCAATTTACAAATCAATTAGCATTACTGTGCGATGTTAGAGAAATA
TTTCAGATGATTTTCCTACTCAGAAAGAACCTGGTA

FASTA

>Os12t0545900-04 class=Sequence position=chr12:22054097..22055332 (+ strand)
GATGGCACGA ACATTGAGTT TCTAATTGTT CTATTTGTAT CAGAAGCTAC AACATGTAAA GTTGAGTTAC ATTGTTTGTC
TTCAAAGTAA AAGAGACAGA AAACTGCCCC AAATCCCCCC CAAGTCCTTT GTTTCTTCCT TTGCTCTGAA TTTTGTCGGA
ACAGCTACAG AGTGCGCCCA AAGTGTTCGT CCATGGTTCT TCCCAACAAA ACTAATTCTA ATGAATAAAT AATCTTTTAT
TTTGCAAAAT ATAATTTAAG AACTGCTGCT CCAAATTTCA TAATAGGGAA AAGAGTAAAA AAATTCATGA CATTTAGAGG
CCCAGCACTA GCCTAGGAAT TTGCTTCCCA TATATCTTGT CCAGTGCTCA TGCCATGTTG AAATACTTTT CATTTTTCTT
TCATCAAATT GCATGCTTCA CCAGCACGTC CATATTGAAT GCCATCTAAA CACTAAAAAT ACATCCCACA AATCCTTTAG
CATTTTTAAC CCGAAAACTT GCTACCACAA GCTTTCCCAG GATGCACATA CTGAATCTCT CTATGTTGAC GTTTTTTTTT
TGGCAAACAA AAACTCAACT AACAATTTGA GTATAATTTG TGGACAACAT AAATGCTACT CAATGGACAT ATGAAAGAAA
AGCAGAGACA TAGATGAGCA ACATGAGAAC TTCAGCTTGA GATATACATA CCAACTAGAG ATTCAGTTGC TACTGCTTTA
CAAGACTATT TCATAGCACC TACATATAGG AGTGGGAGGC ATGGTGAAGC AAAGAAGTGC ATTGTTTGTC TACCATCCAT
CAAGAGTAAA ATTTTTATCA ACACGCAGTT CAGATACTCT AGATGCAGTA TAACTTCTCG GGTCTATCTA TAACGGAGCC
GCCGCTTCAA TTTTCCTATT GCCTAACCAA TGGAGCAAAC AATGTATAGT GTCTAGATGG CTTTGGAAAG CAATCCAAGA
ACATCAGTGG TAGCTTGCTC CTAGTCCAGA AGGAAAATGT GTCGCTTGAC GAGGTACCAC TGAATCTTCA CCAGCTATCG
TGAATGGGAT GATCTGAGTT GGATGTGCAA CCAAGACTTC GCCACAAAAA TGGGAAATAG TCATACCAAG ATGAAGCAAG
CTAAGATGCA TATATTACCA ATTATATATG TATCCCAATT TACAAATCAA TTAGCATTAC TGTGCGATGT TAGAGAAATA
TTTCAGATGA TTTTCCTACT CAGAAAGAAC CTGGTA

Locus: Os12g0545900

Loading...

Locus: Os12g0545900

Loading...