Os12t0569700-02

Locus

Os12g0569700

Description

Non-protein coding transcript.

RAP-DB Gene Symbol Synonym(s)

RAP-DB Gene Name Synonym(s)

CGSNL Gene Symbol

HSP23.7

CGSNL Gene Name

23.7 KDA HEAT SHOCK PROTEIN

Oryzabase Gene Symbol Synonym(s)

OsHsp23.7, OsHSP23.7

Oryzabase Gene Name Synonym(s)

23.7 kDa heat shock protein

Transcript Evidence

AK062695 (DDBJ, Best hit)

Protein Evidence

NONE

Literature

Note

  • CDS sequences are different between Build 5 and IRGSP-1.0.

Manual Curation

Full-length cDNA

001-106-A08 (Online Clone Ordering)

Expression Databases

TENOR (Os12t0569700-02)

Others

Oryzabase (10375)

Transcript

475 bp

>Os12t0569700-02 Non-protein coding transcript.
AAGTCCTCCCATCCAGCAGCTCAGCCGCCACAAGCCATGGCCGATGCGAGCTCGGCCGCC
GTCGCTGCCCCCAAGCCCCAACTGGCCGCCGGCACTTGAGCACCAAGCAGGGCCAGCTCG
ACGACGCCGTCGCCGCCCGCCACCAAGCTCGAACAGATCAGCTCCAGCAATGTTCAATCC
AACGACTTTTGCATTGATTGATTGATTTTCTCTGCTCGTGTGATTGTGTGATTGGAATCG
ACTAGCTTGAACCAATTGATAGTATCCCTGTGCTGTGCGTGCATTGCATGTGTACATATT
ACCAAATCTCTGTTGCATATGGATCCACTCTTGGATATCGGTTTTCGCTTGAATGCCGTT
TTCTTCTGTTATTTTGTTGTTCCTTTTTTTAAGCTATAAAACCCAACCTTCTCTTTATGA
TCTGTTTGTTTTCAATATTGTAATTTTTTTTCTGGAATTTGTTGTTAATTATAAC

FASTA

>Os12t0569700-02 class=Sequence position=chr12:23442175..23442649 (+ strand)
AAGTCCTCCC ATCCAGCAGC TCAGCCGCCA CAAGCCATGG CCGATGCGAG CTCGGCCGCC GTCGCTGCCC CCAAGCCCCA
ACTGGCCGCC GGCACTTGAG CACCAAGCAG GGCCAGCTCG ACGACGCCGT CGCCGCCCGC CACCAAGCTC GAACAGATCA
GCTCCAGCAA TGTTCAATCC AACGACTTTT GCATTGATTG ATTGATTTTC TCTGCTCGTG TGATTGTGTG ATTGGAATCG
ACTAGCTTGA ACCAATTGAT AGTATCCCTG TGCTGTGCGT GCATTGCATG TGTACATATT ACCAAATCTC TGTTGCATAT
GGATCCACTC TTGGATATCG GTTTTCGCTT GAATGCCGTT TTCTTCTGTT ATTTTGTTGT TCCTTTTTTT AAGCTATAAA
ACCCAACCTT CTCTTTATGA TCTGTTTGTT TTCAATATTG TAATTTTTTT TCTGGAATTT GTTGTTAATT ATAAC

Locus: Os12g0569700

Loading...

Locus: Os12g0569700

Loading...