HD1 (HEADING DATE 1) : Os06g0275000

RAP-DB

Locus ID: Os06g0275000
Transcript ID: Os06t0275000-01 (chr06:9336376-9338569)
Description: Zinc finger protein, Heading date
RAP-DB Gene symbol: SE1, Se1(Lm, Lf, Rs, Fl), se(t), Hd1, HD1, Fl, Lm, Se1, K, Rs, Lf, Se-1, Hd1(t), qHD1(t), OsA, OsBBX18, Hd1/OsA, OsCCT21
RAP-DB Gene name: PHOTOSENSITIVITY 1, Photosensitivity1, Photosensitivity 1, Photoperiod sensitivity 1, Heading date, Photoperiod-sensitivity-1, HEADING DATE 1, Arabidopsis CONSTANS(CO) gene ortholog, ortholog of Arabidopsis CONSTANS, B-box-containing protein 18, CCT domain-containing gene 21, CCT (CO, CO-LIKE and TOC1) domain protein 21, CCT domain protein 21
Gene Ontolgy: protein binding (GO:0005515)
intracellular (GO:0005622)
zinc ion binding (GO:0008270)
Links: TASUKE (for RAP-DB), GBrowse

Oryzabase

CGSNL Gene symbol: SE1
CGSNL Gene name: PHOTOSENSITIVITY 1
Oryzabase Gene symbol: Se1(Lm, Lf, Rs, Fl), se(t), Hd1, HD1, Fl, Lm, Se1, K, Rs, Lf, Se-1, Hd1(t), qHD1(t), OsA, OsBBX18, Hd1/OsA, OsCCT21
Oryzabase Gene name: Photosensitivity1, Photosensitivity 1, Photoperiod sensitivity 1, Heading date, Photoperiod-sensitivity-1, HEADING DATE 1, Arabidopsis CONSTANS(CO) gene ortholog, ortholog of Arabidopsis CONSTANS, B-box-containing protein 18, CCT domain-containing gene 21, CCT (CO, CO-LIKE and TOC1) domain protein 21, CCT domain protein 21
Gene Ontolgy: DNA binding (GO:0003677)
transcription factor activity (GO:0003700)
protein binding (GO:0005515)
intracellular (GO:0005622)
nucleus (GO:0005634)
transcription, DNA-dependent (GO:0006351)
circadian rhythm (GO:0007623)
zinc ion binding (GO:0008270)
photoperiodism (GO:0009648)
flower development (GO:0009908)
regulation of flower development (GO:0009909)
inflorescence development (GO:0010229)
cell differentiation (GO:0030154)
negative regulation of transcription, DNA-dependent (GO:0045892)
long-day photoperiodism (GO:0048571)
short-day photoperiodism (GO:0048572)
positive regulation of short-day photoperiodism, flowering (GO:0048576)
negative regulation of long-day photoperiodism, flowering (GO:0048579)
Trait Ontolgy: inflorescence branching (TO:0000050)
days to heading (TO:0000137)
photoperiod sensitivity (TO:0000229)
yield trait (TO:0000371)
filled grain percentage (TO:0000448)
days to maturity (TO:0000469)
grain number (TO:0002759)
panicle size (TO:0006032)
Plant Ontolgy : seed (PO:0009010)
portion of meristem tissue (PO:0009013)
vascular leaf (PO:0009025)
inflorescence (PO:0009049)
spikelet floret (PO:0009082)
Links: Oryzabase

Gene information from literatures

Gene function

  • Hd1, an ortholog of CONSTANS of Arabidopsis, promotes flowering under short-day conditions but strongly represses flowering under long-day conditions through regulation of the expression of Hd3a. The function of Hd1 probably is to affect transcription activation because of the presence of a zinc finger domain.

Functional variations

Representative variations
Var# Cultivar 1 Cultivar 2 HGVS Description References
V1 NPB Ginbouzu g.9336850C>T
p.His106Tyr
Both alleles are functional for photoperiod response PMID:11148291
PMID:19246394
V2 NPB Ginbouzu, Bengal3, Cypress4, PSRR-15, Taichung 65 g.9336867_9336868insGCCAGGCGC CACCAGCGCGTCCCCGTCGCGCCGCTC
p.Leu111_Pro112ins12
(The ins. position and sequence are different from those in TASUKE: g.9336861_9336862insCCGCTCGCCAGGCGCCACCAGCGCGTCCCCGTCGCG)
This region is thought to be important for DNA–DNA interaction
and is highly conserved between rice and Arabidopsis or B. napus.
PMID:11148291
PMID:19246394
V3 NPB, PSRR-1 Kasalath, Bengal, Cypress g.9338005_9338006del
p.Phe279Leufs*64
Kasalath, having non-functional allele (premature stop codon by frame shift), show later heading than Nipponbare under SD conditions, but earlier heading under LD conditions. PMID:11148291
PMID:19246394
V4 NPB, Ginbouzu MA SHO, KHAO NOK, KHAU MAC KHO g.9338243C>T
p.Arg358*
Cultivars 2 have non-functional allele (premature stop codon in CCT domain). PMID:19246394
V5 NPB, Ginbouzu SHUUSOUSHU g.9336854del
p.Ala108Argfs*135
(not detected in TASUKE)
Cultivar 2 has non-functional allele (premature stop codon by frame shift) and no CCT domain. PMID:19246394
V6 NPB, Ginbouzu TADUKAN, CALOTOC, PINULUPOT 1, BASILANON |g.9337102del
p.Tyr191Thrfs*52
Cultivar 2 has non-functional allele (premature stop codon by frame shift) and no CCT domain. PMID:19246394
V7 NPB, Ginbouzu DAVAO 1, IR 58, QINGYU(SEIYU), SHWE NANG GYI, MILYANG 23 |g.9338221_ 9338224del
p.Lys352fs
(INFO_REALIGN_3_PRIME3)
Cultivar 2 has non-functional allele with 4bp deletion in CCT domain. PMID:19246394
V8 NPB, Ginbouzu Taichung 65 1901bp insertion in exon 2 results in a premature stop codon (TAG) ahead of the CCT motif. Cultivar 2 has non-functional allele. PMID:15078816
  • The basic amino acid motif (RRHQR), which is a common feature between the Arabidopsis and B. napus CO family in the C terminus of the zinc finger domain, was present in the Ginbouzu Hd1 protein but not in Nipponbare. One single-base substitution (V1) and a 36-bp insertion (V2) in the terminal region of a zinc finger domain, including the basic amino acid motif RRHQR, are present in the Ginbouzu Hd1 allele but not in the Nipponbare allele, although both alleles are functional for photoperiod response. This sequence is also present in Kasalath, which makes it more likely that a 36-bp deletion (V2) occurred in the Nipponbare Hd1 allele. No evidence explains the functional difference between the Nipponbare and Ginbouzu Hd1 alleles. The inhibition of heading under natural field conditions by the Hd1 allele of Nipponbare is less than that of Ginbouzu (PMID:11148291).
  • The Nipponbare and Kasalath Hd1 alleles have many structural differences. (4 single-base substitutions, 1 two-base substitution, a 36-bp insertion, and a 33-bp deletion in the first exon as well as 2 single-base substitutions and a two-base deletion in the second exon. A 2-bp deletion in the second exon in the Kasalath allele (V3) results in a premature stop codon. Thus, the Kasalath Hd1 protein could be shorter than the Nipponbare protein because it is missing the C-terminal region. Kasalath exhibits later heading than Nipponbare under SD conditions but earlier heading under LD conditions (PMID:11148291).
  • In addition to the previously reported 2-bp deletion found in cultivar (cv.) Kasalath (V3), 3 deletions and 1 SNP (V4, V5, V6, V7) that could cause defects in the entire or part of the CCT domains of 8 protein types were reported (PMID:19246394).
  • Retroelement-like fragment is inserted into the second exon, and the Taichung 65 allele of Hd1 seems to be a loss-of-function allele (V8)(PMID:15078816).

Gene expression

  • The amount of Hd1 mRNA was not greatly affected by a change in length of the photoperiod. The quantities of Nipponbare mRNA at Hd1 did not change with the transition from LD to SD conditions, which was associated with the initiation of transition to heading (PMID:11148291).
  • SE1 (HD1) mRNA levels under LD conditions were similar to those under SD conditions, although the duration of SE1 mRNA expression was slightly longer under LD than under SD conditions (PMID:12154129).
  • Insertion of a retroelement-like fragment in the second exon of Hd1 was observed in Taichung 65. The Hd1 allele in Taichung 65 seemed to be a loss-of-function allele, because Hd1 mRNA was severely reduced in Taichung 65, probably by nonsense-mediated decay (PMID:15078816 ).

Other information

  • Cultivars that carry functional Hd1 alleles tends to show higher Hd3a expression levels and earlier flowering times, whereas those carrying nonfunctional Hd1 alleles tends to show lower Hd3a expression levels and later flowering times. The nucleotide polymorphisms observed in Hd1 might be one of the main causes for the diversity of flowering time in cultivated rice (PMID:19246394). A single-base substitution and a 36-bp insertion in the first exon of the Ginbouzu Hd1 sequence were observed compared with that of Nipponbare Hd1, although both alleles were functional for photoperiod response. Nipponbare and Ginbouzu showed a strong photoperiod response, but Kasalath showed a weak response. Early heading plants were homozygous for the Kasalath allele at Hd1, in contrast with plants that were homozygous or heterozygous for the Nipponbare allele, which were later heading under natural field conditions (PMID:11148291). Several exceptions were also reported (e.g. KHAU TAN CHIEM, KEMASIN, and BINGARA have a functional Hd1 allele but show low Hd3a levels and a late-flowering phenotype) (PMID:19246394).
  • In the case of Hd1, high resolution linkage mapping clearly suggested that a functional allele of Hd1 inhibited heading under natural field conditions (more like LD conditions in the growth chamber). On the other hand, transformation analysis revealed that Hd1 promoted heading under SD conditions. These results suggest that Hd1 might be bifunctional under SD and LD conditions, promoting heading under SD conditions and inhibiting it under LD conditions. Hd1 plays a central role in the expression of photoperiod response under both SD and LD conditions (?).
  • The Hd1 from the weedy rice accession in a cultivated rice background exhibited late flowering under LD condition. This observation provided many clues for involvement of unidentified genes other than Ghd7 in suppression of Hd1. The report suggested the new gene as a missing link between Hd1 and florigen genes and may be functioning downstream of Hd1 involving a post transcriptional mechanism (?).
  • The physical interaction between Ghd7 and Hd1 was responsible for extreme late flowering under LD condition. It is reported that biological interactions between Ghd7 and Hd1, which together repress Early heading date 1 (Ehd1), a key floral inducer under non-inductive LD conditions (PMID:26991872).

References

  • Yano M et al. 2000 Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS. Plant Cell PMID:11148291
  • Izawa T et al. 2002 Phytochrome mediates the external light signal to repress FT orthologs in photoperiodic flowering of rice. Genes Dev. PMID:12154129
  • Doi K et al. 2004 Ehd1, a B-type response regulator in rice, confers short-day promotion of flowering and controls FT-like gene expression independently of Hd1. Genes Dev. PMID:15078816
  • Takahashi Y et al. 2009 Variations in Hd1 proteins, Hd3a promoters, and Ehd1 expression levels contribute to diversity of flowering time in cultivated rice. Proc Natl Acad Sci U S A. PMID:19246394
  • Nemoto Y et al. 2016 Hd1,a CONSTANS ortholog in rice, functions as an Ehd1 repressor through interaction with monocot-specific CCT-domain protein Ghd7. Plant J. 26991872